\
| Variant ID: vg0614459942 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 14459942 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTAGTTTTAATAGTCAGCTCTCTCTGTTTGCTGGTTCTGTGTGGGATTTTCAGATGGTGACAACCAGGAGAAGCGCTGTTACTGGCGAAGGCAGTCATCC[C/T]
GAAGGCAGCAACCCCAACAACCATGACAGCCCACCTCCACCTCCTCCCCACCACCACCACCGCCACCTGACACCAACCCCATCCTCACCCAAATCCTCGC
GCGAGGATTTGGGTGAGGATGGGGTTGGTGTCAGGTGGCGGTGGTGGTGGTGGGGAGGAGGTGGAGGTGGGCTGTCATGGTTGTTGGGGTTGCTGCCTTC[G/A]
GGATGACTGCCTTCGCCAGTAACAGCGCTTCTCCTGGTTGTCACCATCTGAAAATCCCACACAGAACCAGCAAACAGAGAGAGCTGACTATTAAAACTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.20% | 24.50% | 6.33% | 11.02% | NA |
| All Indica | 2759 | 35.40% | 39.80% | 10.00% | 14.75% | NA |
| All Japonica | 1512 | 92.40% | 0.30% | 0.66% | 6.61% | NA |
| Aus | 269 | 84.00% | 11.50% | 2.60% | 1.86% | NA |
| Indica I | 595 | 34.30% | 18.20% | 18.15% | 29.41% | NA |
| Indica II | 465 | 24.10% | 49.50% | 12.90% | 13.55% | NA |
| Indica III | 913 | 37.80% | 49.90% | 4.49% | 7.78% | NA |
| Indica Intermediate | 786 | 40.20% | 38.80% | 8.52% | 12.47% | NA |
| Temperate Japonica | 767 | 97.10% | 0.10% | 0.39% | 2.35% | NA |
| Tropical Japonica | 504 | 84.70% | 0.80% | 0.99% | 13.49% | NA |
| Japonica Intermediate | 241 | 93.40% | 0.00% | 0.83% | 5.81% | NA |
| VI/Aromatic | 96 | 95.80% | 1.00% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 64.40% | 22.20% | 4.44% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0614459942 | C -> T | LOC_Os06g24630.1 | upstream_gene_variant ; 465.0bp to feature; MODIFIER | silent_mutation | Average:26.834; most accessible tissue: Callus, score: 46.604 | N | N | N | N |
| vg0614459942 | C -> T | LOC_Os06g24620.1 | downstream_gene_variant ; 296.0bp to feature; MODIFIER | silent_mutation | Average:26.834; most accessible tissue: Callus, score: 46.604 | N | N | N | N |
| vg0614459942 | C -> T | LOC_Os06g24620-LOC_Os06g24630 | intergenic_region ; MODIFIER | silent_mutation | Average:26.834; most accessible tissue: Callus, score: 46.604 | N | N | N | N |
| vg0614459942 | C -> DEL | N | N | silent_mutation | Average:26.834; most accessible tissue: Callus, score: 46.604 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0614459942 | NA | 3.67E-06 | mr1252 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614459942 | NA | 6.75E-06 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614459942 | NA | 1.17E-08 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614459942 | NA | 1.94E-11 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614459942 | NA | 2.97E-11 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614459942 | NA | 3.34E-07 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614459942 | NA | 1.44E-07 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614459942 | NA | 4.76E-16 | mr1830_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614459942 | NA | 7.58E-12 | mr1830_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614459942 | 3.06E-07 | 1.31E-22 | mr1846_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614459942 | 4.43E-07 | 2.18E-23 | mr1846_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |