\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614459942:

Variant ID: vg0614459942 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 14459942
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAGTTTTAATAGTCAGCTCTCTCTGTTTGCTGGTTCTGTGTGGGATTTTCAGATGGTGACAACCAGGAGAAGCGCTGTTACTGGCGAAGGCAGTCATCC[C/T]
GAAGGCAGCAACCCCAACAACCATGACAGCCCACCTCCACCTCCTCCCCACCACCACCACCGCCACCTGACACCAACCCCATCCTCACCCAAATCCTCGC

Reverse complement sequence

GCGAGGATTTGGGTGAGGATGGGGTTGGTGTCAGGTGGCGGTGGTGGTGGTGGGGAGGAGGTGGAGGTGGGCTGTCATGGTTGTTGGGGTTGCTGCCTTC[G/A]
GGATGACTGCCTTCGCCAGTAACAGCGCTTCTCCTGGTTGTCACCATCTGAAAATCCCACACAGAACCAGCAAACAGAGAGAGCTGACTATTAAAACTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.20% 24.50% 6.33% 11.02% NA
All Indica  2759 35.40% 39.80% 10.00% 14.75% NA
All Japonica  1512 92.40% 0.30% 0.66% 6.61% NA
Aus  269 84.00% 11.50% 2.60% 1.86% NA
Indica I  595 34.30% 18.20% 18.15% 29.41% NA
Indica II  465 24.10% 49.50% 12.90% 13.55% NA
Indica III  913 37.80% 49.90% 4.49% 7.78% NA
Indica Intermediate  786 40.20% 38.80% 8.52% 12.47% NA
Temperate Japonica  767 97.10% 0.10% 0.39% 2.35% NA
Tropical Japonica  504 84.70% 0.80% 0.99% 13.49% NA
Japonica Intermediate  241 93.40% 0.00% 0.83% 5.81% NA
VI/Aromatic  96 95.80% 1.00% 2.08% 1.04% NA
Intermediate  90 64.40% 22.20% 4.44% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0614459942 C -> T LOC_Os06g24630.1 upstream_gene_variant ; 465.0bp to feature; MODIFIER silent_mutation Average:26.834; most accessible tissue: Callus, score: 46.604 N N N N
vg0614459942 C -> T LOC_Os06g24620.1 downstream_gene_variant ; 296.0bp to feature; MODIFIER silent_mutation Average:26.834; most accessible tissue: Callus, score: 46.604 N N N N
vg0614459942 C -> T LOC_Os06g24620-LOC_Os06g24630 intergenic_region ; MODIFIER silent_mutation Average:26.834; most accessible tissue: Callus, score: 46.604 N N N N
vg0614459942 C -> DEL N N silent_mutation Average:26.834; most accessible tissue: Callus, score: 46.604 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0614459942 NA 3.67E-06 mr1252 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942 NA 6.75E-06 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942 NA 1.17E-08 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942 NA 1.94E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942 NA 2.97E-11 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942 NA 3.34E-07 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942 NA 1.44E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942 NA 4.76E-16 mr1830_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942 NA 7.58E-12 mr1830_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942 3.06E-07 1.31E-22 mr1846_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614459942 4.43E-07 2.18E-23 mr1846_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251