Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614122855:

Variant ID: vg0614122855 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 14122855
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTGCTTTCCTATGATGTCTTGAGTGTGGAAAGGAATATTTTTCTGATTTGATCTGACCTTGGCTGTTTTATTTTATTGGGACTAGCACATATAGGCTG[G/C]
CTGGCAATATGTTTTGATTTGTTTGTGGTCGTATGGGAAATTAAGCTCTGTGGTCGTTGCATATCATGAAATTAAGCTTCTAATTCCTCCGTTTCACAAT

Reverse complement sequence

ATTGTGAAACGGAGGAATTAGAAGCTTAATTTCATGATATGCAACGACCACAGAGCTTAATTTCCCATACGACCACAAACAAATCAAAACATATTGCCAG[C/G]
CAGCCTATATGTGCTAGTCCCAATAAAATAAAACAGCCAAGGTCAGATCAAATCAGAAAAATATTCCTTTCCACACTCAAGACATCATAGGAAAGCAACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.80%	5.50%	3.68%	0.00%	NA
All Indica	2759	85.20%	8.90%	5.94%	0.00%	NA
All Japonica	1512	99.70%	0.10%	0.26%	0.00%	NA
Aus	269	98.90%	0.00%	1.12%	0.00%	NA
Indica I	595	77.10%	6.90%	15.97%	0.00%	NA
Indica II	465	94.60%	1.90%	3.44%	0.00%	NA
Indica III	913	91.70%	8.00%	0.33%	0.00%	NA
Indica Intermediate	786	78.10%	15.50%	6.36%	0.00%	NA
Temperate Japonica	767	99.50%	0.10%	0.39%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	93.30%	3.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0614122855	G -> C	LOC_Os06g24130.1	upstream_gene_variant ; 4154.0bp to feature; MODIFIER	silent_mutation	Average:50.585; most accessible tissue: Zhenshan97 root, score: 65.566	N	N	N	N
vg0614122855	G -> C	LOC_Os06g24130-LOC_Os06g24150	intergenic_region ; MODIFIER	silent_mutation	Average:50.585; most accessible tissue: Zhenshan97 root, score: 65.566	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0614122855	NA	4.90E-07	mr1020	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614122855	NA	6.39E-06	mr1021	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614122855	NA	6.62E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614122855	NA	5.06E-07	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614122855	NA	8.59E-08	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614122855	7.42E-06	NA	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614122855	NA	7.50E-07	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614122855	NA	1.31E-06	mr1477	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614122855	8.87E-07	NA	mr1478	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614122855	3.65E-06	1.60E-07	mr1478	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614122855	NA	6.20E-08	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614122855	NA	6.18E-06	mr1725	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614122855	6.53E-06	NA	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614122855	6.49E-06	3.05E-07	mr1971	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614122855	NA	2.06E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251