\
| Variant ID: vg0614034992 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 14034992 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, G: 0.17, others allele: 0.00, population size: 89. )
TCACACCACCGTTCATGGGCGTCCACGTCTTCATCGACCGGCTTGCCTTTGCCGCTGCCGACTGGTGTCTTCGCCTACACGGCTGGCCTATTATGCCGCC[G/A]
TTGTTGGCGTCTATGACTTCAACGCCGGCCTGCCTTCGTCGCCGCCGACTGGTGTCTTCATTGTTATTAATGGACGACTTTGTTCCCACATTGGCCACCT
AGGTGGCCAATGTGGGAACAAAGTCGTCCATTAATAACAATGAAGACACCAGTCGGCGGCGACGAAGGCAGGCCGGCGTTGAAGTCATAGACGCCAACAA[C/T]
GGCGGCATAATAGGCCAGCCGTGTAGGCGAAGACACCAGTCGGCAGCGGCAAAGGCAAGCCGGTCGATGAAGACGTGGACGCCCATGAACGGTGGTGTGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.10% | 32.20% | 3.72% | 30.05% | NA |
| All Indica | 2759 | 52.20% | 3.60% | 1.67% | 42.62% | NA |
| All Japonica | 1512 | 1.30% | 91.30% | 0.86% | 6.61% | NA |
| Aus | 269 | 43.50% | 1.50% | 11.15% | 43.87% | NA |
| Indica I | 595 | 85.70% | 3.70% | 0.34% | 10.25% | NA |
| Indica II | 465 | 73.80% | 2.60% | 1.29% | 22.37% | NA |
| Indica III | 913 | 15.30% | 2.70% | 2.85% | 79.08% | NA |
| Indica Intermediate | 786 | 56.70% | 5.00% | 1.53% | 36.77% | NA |
| Temperate Japonica | 767 | 1.60% | 96.60% | 0.00% | 1.83% | NA |
| Tropical Japonica | 504 | 0.80% | 82.70% | 1.98% | 14.48% | NA |
| Japonica Intermediate | 241 | 1.20% | 92.10% | 1.24% | 5.39% | NA |
| VI/Aromatic | 96 | 11.50% | 3.10% | 81.25% | 4.17% | NA |
| Intermediate | 90 | 26.70% | 38.90% | 10.00% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0614034992 | G -> A | LOC_Os06g24020.1 | upstream_gene_variant ; 3362.0bp to feature; MODIFIER | silent_mutation | Average:28.754; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| vg0614034992 | G -> A | LOC_Os06g24030.1 | upstream_gene_variant ; 1368.0bp to feature; MODIFIER | silent_mutation | Average:28.754; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| vg0614034992 | G -> A | LOC_Os06g24020-LOC_Os06g24030 | intergenic_region ; MODIFIER | silent_mutation | Average:28.754; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| vg0614034992 | G -> DEL | N | N | silent_mutation | Average:28.754; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0614034992 | 1.88E-06 | NA | mr1565 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614034992 | NA | 4.96E-08 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614034992 | NA | 4.03E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |