Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0614034992:

Variant ID: vg0614034992 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 14034992
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, G: 0.17, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

TCACACCACCGTTCATGGGCGTCCACGTCTTCATCGACCGGCTTGCCTTTGCCGCTGCCGACTGGTGTCTTCGCCTACACGGCTGGCCTATTATGCCGCC[G/A]
TTGTTGGCGTCTATGACTTCAACGCCGGCCTGCCTTCGTCGCCGCCGACTGGTGTCTTCATTGTTATTAATGGACGACTTTGTTCCCACATTGGCCACCT

Reverse complement sequence

AGGTGGCCAATGTGGGAACAAAGTCGTCCATTAATAACAATGAAGACACCAGTCGGCGGCGACGAAGGCAGGCCGGCGTTGAAGTCATAGACGCCAACAA[C/T]
GGCGGCATAATAGGCCAGCCGTGTAGGCGAAGACACCAGTCGGCAGCGGCAAAGGCAAGCCGGTCGATGAAGACGTGGACGCCCATGAACGGTGGTGTGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.10%	32.20%	3.72%	30.05%	NA
All Indica	2759	52.20%	3.60%	1.67%	42.62%	NA
All Japonica	1512	1.30%	91.30%	0.86%	6.61%	NA
Aus	269	43.50%	1.50%	11.15%	43.87%	NA
Indica I	595	85.70%	3.70%	0.34%	10.25%	NA
Indica II	465	73.80%	2.60%	1.29%	22.37%	NA
Indica III	913	15.30%	2.70%	2.85%	79.08%	NA
Indica Intermediate	786	56.70%	5.00%	1.53%	36.77%	NA
Temperate Japonica	767	1.60%	96.60%	0.00%	1.83%	NA
Tropical Japonica	504	0.80%	82.70%	1.98%	14.48%	NA
Japonica Intermediate	241	1.20%	92.10%	1.24%	5.39%	NA
VI/Aromatic	96	11.50%	3.10%	81.25%	4.17%	NA
Intermediate	90	26.70%	38.90%	10.00%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0614034992	G -> A	LOC_Os06g24020.1	upstream_gene_variant ; 3362.0bp to feature; MODIFIER	silent_mutation	Average:28.754; most accessible tissue: Zhenshan97 flag leaf, score: 77.203	N	N	N	N
vg0614034992	G -> A	LOC_Os06g24030.1	upstream_gene_variant ; 1368.0bp to feature; MODIFIER	silent_mutation	Average:28.754; most accessible tissue: Zhenshan97 flag leaf, score: 77.203	N	N	N	N
vg0614034992	G -> A	LOC_Os06g24020-LOC_Os06g24030	intergenic_region ; MODIFIER	silent_mutation	Average:28.754; most accessible tissue: Zhenshan97 flag leaf, score: 77.203	N	N	N	N
vg0614034992	G -> DEL	N	N	silent_mutation	Average:28.754; most accessible tissue: Zhenshan97 flag leaf, score: 77.203	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0614034992	1.88E-06	NA	mr1565	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614034992	NA	4.96E-08	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614034992	NA	4.03E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251