Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614016173:

Variant ID: vg0614016173 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 14016173
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

GATTGATCGTCCGTTTTGCTACCGATACTCCTCCATTTTGTATTATTCTCTGCAAGAGGTTTCTAGTGGAATATAACTTATTTTAACATAAATATGTATT[G/A]
CAAGCATAACTAGATCTTCTTTATTTTGGTAATATTGACAGGCGTAACTAATCGAGAACGGCCGTCAACAACAGACTGTTAGAACCAACTGTCAAAACCT

Reverse complement sequence

AGGTTTTGACAGTTGGTTCTAACAGTCTGTTGTTGACGGCCGTTCTCGATTAGTTACGCCTGTCAATATTACCAAAATAAAGAAGATCTAGTTATGCTTG[C/T]
AATACATATTTATGTTAAAATAAGTTATATTCCACTAGAAACCTCTTGCAGAGAATAATACAAAATGGAGGAGTATCGGTAGCAAAACGGACGATCAATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.50%	6.00%	3.51%	0.00%	NA
All Indica	2759	84.60%	9.70%	5.69%	0.00%	NA
All Japonica	1512	99.70%	0.10%	0.20%	0.00%	NA
Aus	269	98.90%	0.00%	1.12%	0.00%	NA
Indica I	595	76.10%	8.90%	14.96%	0.00%	NA
Indica II	465	92.50%	1.90%	5.59%	0.00%	NA
Indica III	913	91.60%	8.10%	0.33%	0.00%	NA
Indica Intermediate	786	78.10%	16.90%	4.96%	0.00%	NA
Temperate Japonica	767	99.60%	0.30%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	93.30%	3.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0614016173	G -> A	LOC_Os06g23990.1	upstream_gene_variant ; 1176.0bp to feature; MODIFIER	silent_mutation	Average:34.827; most accessible tissue: Zhenshan97 young leaf, score: 56.533	N	N	N	N
vg0614016173	G -> A	LOC_Os06g24000.1	upstream_gene_variant ; 4991.0bp to feature; MODIFIER	silent_mutation	Average:34.827; most accessible tissue: Zhenshan97 young leaf, score: 56.533	N	N	N	N
vg0614016173	G -> A	LOC_Os06g23980-LOC_Os06g23990	intergenic_region ; MODIFIER	silent_mutation	Average:34.827; most accessible tissue: Zhenshan97 young leaf, score: 56.533	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0614016173	2.62E-06	NA	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0614016173	5.73E-07	1.34E-16	Plant_height	Ind_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0614016173	NA	3.30E-07	mr1020	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173	NA	5.13E-06	mr1021	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173	NA	3.81E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173	NA	1.06E-07	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173	NA	4.52E-07	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173	NA	5.11E-07	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173	NA	1.49E-06	mr1477	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173	8.16E-06	8.89E-14	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173	NA	4.22E-08	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173	NA	7.37E-08	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173	8.20E-06	NA	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173	NA	1.13E-07	mr1971	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173	NA	8.73E-06	mr1268_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173	NA	2.96E-06	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173	NA	1.91E-06	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251