\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614016173:

Variant ID: vg0614016173 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 14016173
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


GATTGATCGTCCGTTTTGCTACCGATACTCCTCCATTTTGTATTATTCTCTGCAAGAGGTTTCTAGTGGAATATAACTTATTTTAACATAAATATGTATT[G/A]
CAAGCATAACTAGATCTTCTTTATTTTGGTAATATTGACAGGCGTAACTAATCGAGAACGGCCGTCAACAACAGACTGTTAGAACCAACTGTCAAAACCT

Reverse complement sequence

AGGTTTTGACAGTTGGTTCTAACAGTCTGTTGTTGACGGCCGTTCTCGATTAGTTACGCCTGTCAATATTACCAAAATAAAGAAGATCTAGTTATGCTTG[C/T]
AATACATATTTATGTTAAAATAAGTTATATTCCACTAGAAACCTCTTGCAGAGAATAATACAAAATGGAGGAGTATCGGTAGCAAAACGGACGATCAATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.50% 6.00% 3.51% 0.00% NA
All Indica  2759 84.60% 9.70% 5.69% 0.00% NA
All Japonica  1512 99.70% 0.10% 0.20% 0.00% NA
Aus  269 98.90% 0.00% 1.12% 0.00% NA
Indica I  595 76.10% 8.90% 14.96% 0.00% NA
Indica II  465 92.50% 1.90% 5.59% 0.00% NA
Indica III  913 91.60% 8.10% 0.33% 0.00% NA
Indica Intermediate  786 78.10% 16.90% 4.96% 0.00% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 93.30% 3.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0614016173 G -> A LOC_Os06g23990.1 upstream_gene_variant ; 1176.0bp to feature; MODIFIER silent_mutation Average:34.827; most accessible tissue: Zhenshan97 young leaf, score: 56.533 N N N N
vg0614016173 G -> A LOC_Os06g24000.1 upstream_gene_variant ; 4991.0bp to feature; MODIFIER silent_mutation Average:34.827; most accessible tissue: Zhenshan97 young leaf, score: 56.533 N N N N
vg0614016173 G -> A LOC_Os06g23980-LOC_Os06g23990 intergenic_region ; MODIFIER silent_mutation Average:34.827; most accessible tissue: Zhenshan97 young leaf, score: 56.533 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0614016173 2.62E-06 NA Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0614016173 5.73E-07 1.34E-16 Plant_height Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0614016173 NA 3.30E-07 mr1020 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173 NA 5.13E-06 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173 NA 3.81E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173 NA 1.06E-07 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173 NA 4.52E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173 NA 5.11E-07 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173 NA 1.49E-06 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173 8.16E-06 8.89E-14 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173 NA 4.22E-08 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173 NA 7.37E-08 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173 8.20E-06 NA mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173 NA 1.13E-07 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173 NA 8.73E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173 NA 2.96E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614016173 NA 1.91E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251