\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613868213:

Variant ID: vg0613868213 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13868213
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATCGCCTTGACATTTTCAATGGATGAGTTGGGCTGCCCCGGAACCCTCCCAGATTCATTTGTAGGTACTAATGCAGCCAATTGAGCCAGCTGTGTTTCT[A/G]
TTATCTTATTAAAACTCAGCTAGTTTTGAAAAGTAAAAGCGAAGCCATCTAGCTTGACATTAATGTTCTCTAAGACCTTGTCATTGGCAGCTAGCTTTTG

Reverse complement sequence

CAAAAGCTAGCTGCCAATGACAAGGTCTTAGAGAACATTAATGTCAAGCTAGATGGCTTCGCTTTTACTTTTCAAAACTAGCTGAGTTTTAATAAGATAA[T/C]
AGAAACACAGCTGGCTCAATTGGCTGCATTAGTACCTACAAATGAATCTGGGAGGGTTCCGGGGCAGCCCAACTCATCCATTGAAAATGTCAAGGCGATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.90% 6.50% 13.90% 45.77% NA
All Indica  2759 7.90% 1.00% 19.90% 71.22% NA
All Japonica  1512 78.70% 17.50% 1.79% 2.05% NA
Aus  269 49.40% 0.40% 14.87% 35.32% NA
Indica I  595 14.60% 0.00% 19.33% 66.05% NA
Indica II  465 8.60% 0.90% 16.77% 73.76% NA
Indica III  913 3.10% 0.20% 21.36% 75.36% NA
Indica Intermediate  786 7.90% 2.80% 20.48% 68.83% NA
Temperate Japonica  767 94.90% 1.30% 0.91% 2.87% NA
Tropical Japonica  504 50.00% 46.20% 3.17% 0.60% NA
Japonica Intermediate  241 87.10% 8.70% 1.66% 2.49% NA
VI/Aromatic  96 29.20% 0.00% 29.17% 41.67% NA
Intermediate  90 35.60% 14.40% 14.44% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613868213 A -> G LOC_Os06g23730.1 missense_variant ; p.Ile220Thr; MODERATE nonsynonymous_codon ; I220T Average:12.989; most accessible tissue: Callus, score: 64.129 benign 1.4 DELETERIOUS 0.02
vg0613868213 A -> DEL LOC_Os06g23730.1 N frameshift_variant Average:12.989; most accessible tissue: Callus, score: 64.129 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613868213 NA 5.25E-21 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 8.06E-07 mr1388 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 5.57E-16 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 9.35E-07 NA mr1422 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 4.15E-08 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 5.82E-08 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 2.60E-10 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 5.86E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 2.81E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 1.30E-06 NA mr1583 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 1.83E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 9.17E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 7.51E-07 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 2.05E-09 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 6.37E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 8.69E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 9.27E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 2.33E-11 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 9.73E-32 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 4.52E-19 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 2.64E-09 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613868213 NA 1.19E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251