Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0613809145:

Variant ID: vg0613809145 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13809145
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


CCATGCCCTCCCTGTCACCATATGCCCTCTCCTCCTCCTCCTCTCTATACACCGTACGTGCGCTGAGTAGGAGTACTAGTAGGAGGAGTATTTTATGTGA[C/T]
GGAGAGGATGGCGATGGTGACGGGATGTGTAGACGTCTCCTGCTGGATCCCTGGGAAGCTACGTGACGAGGGATACTACTACACAGGGTTAATACAGGGT

Reverse complement sequence

ACCCTGTATTAACCCTGTGTAGTAGTATCCCTCGTCACGTAGCTTCCCAGGGATCCAGCAGGAGACGTCTACACATCCCGTCACCATCGCCATCCTCTCC[G/A]
TCACATAAAATACTCCTCCTACTAGTACTCCTACTCAGCGCACGTACGGTGTATAGAGAGGAGGAGGAGGAGAGGGCATATGGTGACAGGGAGGGCATGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.60% 17.60% 2.77% 0.00% NA
All Indica  2759 67.60% 28.10% 4.35% 0.00% NA
All Japonica  1512 99.60% 0.20% 0.20% 0.00% NA
Aus  269 84.40% 13.40% 2.23% 0.00% NA
Indica I  595 82.70% 8.10% 9.24% 0.00% NA
Indica II  465 87.10% 10.10% 2.80% 0.00% NA
Indica III  913 41.80% 57.10% 1.10% 0.00% NA
Indica Intermediate  786 74.40% 20.20% 5.34% 0.00% NA
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 88.50% 10.40% 1.04% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613809145 C -> T LOC_Os06g23670.1 upstream_gene_variant ; 4090.0bp to feature; MODIFIER silent_mutation Average:92.269; most accessible tissue: Zhenshan97 panicle, score: 99.508 N N N N
vg0613809145 C -> T LOC_Os06g23650.1 downstream_gene_variant ; 3330.0bp to feature; MODIFIER silent_mutation Average:92.269; most accessible tissue: Zhenshan97 panicle, score: 99.508 N N N N
vg0613809145 C -> T LOC_Os06g23660.1 downstream_gene_variant ; 2054.0bp to feature; MODIFIER silent_mutation Average:92.269; most accessible tissue: Zhenshan97 panicle, score: 99.508 N N N N
vg0613809145 C -> T LOC_Os06g23650-LOC_Os06g23660 intergenic_region ; MODIFIER silent_mutation Average:92.269; most accessible tissue: Zhenshan97 panicle, score: 99.508 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0613809145 C T 0.04 0.02 0.0 -0.06 0.0 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613809145 8.66E-06 NA mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 1.46E-06 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 1.03E-07 7.47E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 4.36E-06 1.44E-09 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 NA 1.02E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 NA 8.12E-08 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 NA 9.22E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 NA 9.34E-07 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 8.24E-07 NA mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 2.13E-08 NA mr1065_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 3.45E-06 NA mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 5.38E-08 NA mr1067_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 1.21E-07 NA mr1068_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 5.46E-09 4.46E-10 mr1068_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 5.58E-08 NA mr1078_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 8.08E-08 1.82E-08 mr1078_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 2.55E-07 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 9.80E-11 1.88E-13 mr1087_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 8.06E-07 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 3.33E-09 3.22E-08 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 3.41E-06 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 1.45E-06 7.27E-11 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 NA 1.62E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 5.23E-06 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 1.26E-06 6.47E-09 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 1.06E-06 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 5.03E-06 NA mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 NA 6.67E-08 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 1.32E-06 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 7.13E-08 5.33E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 1.60E-07 NA mr1112_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 3.91E-07 1.16E-09 mr1112_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 1.29E-06 NA mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 5.70E-08 3.14E-08 mr1121_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 1.54E-06 8.50E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 3.81E-06 NA mr1200_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 2.16E-08 NA mr1200_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 9.23E-07 NA mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 6.09E-06 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 1.51E-06 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 2.29E-06 NA mr1526_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613809145 5.60E-08 7.90E-10 mr1526_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251