\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613607454:

Variant ID: vg0613607454 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 13607454
Reference Allele: GGGAAlternative Allele: AGGA,G
Primary Allele: AGGASecondary Allele: GGGA

Inferred Ancestral Allele : GGGA (evidence from allele frequency in Oryza rufipogon: GGGA: 0.99, G: 0.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GCAAGCCACAGGAGGGGAGCTGGAAAAGGCCGGGGGAGCGGACTAGGGGCTGTTTGGTTGAAGCCCTGAGCCAAAAGAGCCTGGCGTGATGTGTCCCTGA[GGGA/AGGA,G]
TATCCTGTGTTGTTTGGTTGGTGGCCTGGTTTCATTCCCTGCCTGATCTGAAAAACCTGATAGGTTCATTAGCCTGGCTCAGGCCACCAAAAACGAGCGC

Reverse complement sequence

GCGCTCGTTTTTGGTGGCCTGAGCCAGGCTAATGAACCTATCAGGTTTTTCAGATCAGGCAGGGAATGAAACCAGGCCACCAACCAAACAACACAGGATA[TCCC/TCCT,C]
TCAGGGACACATCACGCCAGGCTCTTTTGGCTCAGGGCTTCAACCAAACAGCCCCTAGTCCGCTCCCCCGGCCTTTTCCAGCTCCCCTCCTGTGGCTTGC

Allele Frequencies:

Populations Population SizeFrequency of AGGA(primary allele) Frequency of GGGA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 38.90% 0.68% 0.00% G: 0.11%
All Indica  2759 94.60% 4.40% 0.94% 0.00% NA
All Japonica  1512 2.50% 96.80% 0.40% 0.00% G: 0.33%
Aus  269 55.80% 44.20% 0.00% 0.00% NA
Indica I  595 92.30% 4.50% 3.19% 0.00% NA
Indica II  465 95.90% 4.10% 0.00% 0.00% NA
Indica III  913 97.40% 2.60% 0.00% 0.00% NA
Indica Intermediate  786 92.50% 6.60% 0.89% 0.00% NA
Temperate Japonica  767 3.70% 95.00% 0.65% 0.00% G: 0.65%
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.30% 0.41% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 43.30% 56.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613607454 GGGA -> G LOC_Os06g23290.1 upstream_gene_variant ; 2538.0bp to feature; MODIFIER silent_mutation Average:98.744; most accessible tissue: Minghui63 root, score: 99.864 N N N N
vg0613607454 GGGA -> G LOC_Os06g23300.1 upstream_gene_variant ; 2612.0bp to feature; MODIFIER silent_mutation Average:98.744; most accessible tissue: Minghui63 root, score: 99.864 N N N N
vg0613607454 GGGA -> G LOC_Os06g23290.2 upstream_gene_variant ; 2539.0bp to feature; MODIFIER silent_mutation Average:98.744; most accessible tissue: Minghui63 root, score: 99.864 N N N N
vg0613607454 GGGA -> G LOC_Os06g23290.3 upstream_gene_variant ; 2538.0bp to feature; MODIFIER silent_mutation Average:98.744; most accessible tissue: Minghui63 root, score: 99.864 N N N N
vg0613607454 GGGA -> G LOC_Os06g23290.4 upstream_gene_variant ; 2538.0bp to feature; MODIFIER silent_mutation Average:98.744; most accessible tissue: Minghui63 root, score: 99.864 N N N N
vg0613607454 GGGA -> G LOC_Os06g23290.5 upstream_gene_variant ; 2538.0bp to feature; MODIFIER silent_mutation Average:98.744; most accessible tissue: Minghui63 root, score: 99.864 N N N N
vg0613607454 GGGA -> G LOC_Os06g23290.6 upstream_gene_variant ; 2538.0bp to feature; MODIFIER silent_mutation Average:98.744; most accessible tissue: Minghui63 root, score: 99.864 N N N N
vg0613607454 GGGA -> G LOC_Os06g23290-LOC_Os06g23300 intergenic_region ; MODIFIER silent_mutation Average:98.744; most accessible tissue: Minghui63 root, score: 99.864 N N N N
vg0613607454 GGGA -> AGGA LOC_Os06g23290.1 upstream_gene_variant ; 2537.0bp to feature; MODIFIER silent_mutation Average:98.744; most accessible tissue: Minghui63 root, score: 99.864 N N N N
vg0613607454 GGGA -> AGGA LOC_Os06g23300.1 upstream_gene_variant ; 2613.0bp to feature; MODIFIER silent_mutation Average:98.744; most accessible tissue: Minghui63 root, score: 99.864 N N N N
vg0613607454 GGGA -> AGGA LOC_Os06g23290.2 upstream_gene_variant ; 2538.0bp to feature; MODIFIER silent_mutation Average:98.744; most accessible tissue: Minghui63 root, score: 99.864 N N N N
vg0613607454 GGGA -> AGGA LOC_Os06g23290.3 upstream_gene_variant ; 2537.0bp to feature; MODIFIER silent_mutation Average:98.744; most accessible tissue: Minghui63 root, score: 99.864 N N N N
vg0613607454 GGGA -> AGGA LOC_Os06g23290.4 upstream_gene_variant ; 2537.0bp to feature; MODIFIER silent_mutation Average:98.744; most accessible tissue: Minghui63 root, score: 99.864 N N N N
vg0613607454 GGGA -> AGGA LOC_Os06g23290.5 upstream_gene_variant ; 2537.0bp to feature; MODIFIER silent_mutation Average:98.744; most accessible tissue: Minghui63 root, score: 99.864 N N N N
vg0613607454 GGGA -> AGGA LOC_Os06g23290.6 upstream_gene_variant ; 2537.0bp to feature; MODIFIER silent_mutation Average:98.744; most accessible tissue: Minghui63 root, score: 99.864 N N N N
vg0613607454 GGGA -> AGGA LOC_Os06g23290-LOC_Os06g23300 intergenic_region ; MODIFIER silent_mutation Average:98.744; most accessible tissue: Minghui63 root, score: 99.864 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0613607454 GGGA AGGA 0.01 -0.04 -0.03 -0.05 0.02 0.03
vg0613607454 GGGA G -0.44 -0.48 -0.41 -0.41 -0.39 -0.48

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613607454 NA 6.66E-22 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 1.19E-09 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 1.02E-41 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 8.08E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 4.43E-45 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 1.36E-26 mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 6.74E-08 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 3.75E-39 mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 5.57E-06 1.07E-09 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 2.26E-22 mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 1.38E-08 4.63E-11 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 4.00E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 1.69E-55 mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 8.50E-08 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 5.45E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 2.87E-36 mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 4.24E-27 mr1145 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 2.22E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 3.12E-21 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 6.96E-07 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 1.01E-29 mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 5.59E-30 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 1.92E-10 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 5.68E-07 1.43E-13 mr1301 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 7.21E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 3.97E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 2.04E-09 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 3.30E-47 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 1.54E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 3.75E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 2.53E-06 mr1993 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 8.22E-12 mr1033_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 1.15E-55 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 1.30E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 5.28E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607454 NA 9.79E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251