\
| Variant ID: vg0613494920 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13494920 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGAGGAGCTTTTTTCAGATTATTGAGTGGCTAAAGACCCACTACCCTTAGATGCCTCTAATAATCCAGAGAAACAAACAACTCGTAGCTTATTTTATGTC[G/A]
GCTTATTATAATCCAGCTATTAGAGTAATCTGATTTAATAATGTATATTAAATTTTAAGCTGAAACAAACAGGGCCTAAGTTTAAACAAACAAGCAGCTT
AAGCTGCTTGTTTGTTTAAACTTAGGCCCTGTTTGTTTCAGCTTAAAATTTAATATACATTATTAAATCAGATTACTCTAATAGCTGGATTATAATAAGC[C/T]
GACATAAAATAAGCTACGAGTTGTTTGTTTCTCTGGATTATTAGAGGCATCTAAGGGTAGTGGGTCTTTAGCCACTCAATAATCTGAAAAAAGCTCCTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.80% | 1.70% | 15.09% | 42.42% | NA |
| All Indica | 2759 | 18.10% | 0.40% | 21.82% | 59.73% | NA |
| All Japonica | 1512 | 90.40% | 1.70% | 1.32% | 6.61% | NA |
| Aus | 269 | 7.10% | 8.20% | 17.10% | 67.66% | NA |
| Indica I | 595 | 16.80% | 0.00% | 34.79% | 48.40% | NA |
| Indica II | 465 | 19.60% | 0.00% | 22.58% | 57.85% | NA |
| Indica III | 913 | 16.30% | 0.50% | 13.25% | 69.88% | NA |
| Indica Intermediate | 786 | 20.20% | 0.60% | 21.50% | 57.63% | NA |
| Temperate Japonica | 767 | 97.40% | 0.00% | 0.91% | 1.69% | NA |
| Tropical Japonica | 504 | 79.20% | 4.40% | 2.18% | 14.29% | NA |
| Japonica Intermediate | 241 | 91.70% | 1.20% | 0.83% | 6.22% | NA |
| VI/Aromatic | 96 | 2.10% | 22.90% | 28.12% | 46.88% | NA |
| Intermediate | 90 | 43.30% | 3.30% | 20.00% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613494920 | G -> A | LOC_Os06g23140.1 | upstream_gene_variant ; 3752.0bp to feature; MODIFIER | silent_mutation | Average:18.947; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0613494920 | G -> A | LOC_Os06g23130.1 | downstream_gene_variant ; 3973.0bp to feature; MODIFIER | silent_mutation | Average:18.947; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0613494920 | G -> A | LOC_Os06g23130-LOC_Os06g23140 | intergenic_region ; MODIFIER | silent_mutation | Average:18.947; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0613494920 | G -> DEL | N | N | silent_mutation | Average:18.947; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613494920 | 3.45E-17 | 9.02E-87 | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613494920 | 9.41E-11 | 5.05E-17 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613494920 | 4.28E-10 | 1.71E-46 | mr1176 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613494920 | 1.13E-07 | 6.58E-11 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613494920 | 1.10E-07 | 1.10E-07 | mr1536 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613494920 | 1.53E-25 | 6.53E-122 | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613494920 | 5.39E-14 | 7.25E-28 | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613494920 | 2.54E-10 | NA | mr1536_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613494920 | 1.58E-13 | 8.61E-16 | mr1536_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613494920 | NA | 7.53E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |