Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0613494920:

Variant ID: vg0613494920 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13494920
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGAGGAGCTTTTTTCAGATTATTGAGTGGCTAAAGACCCACTACCCTTAGATGCCTCTAATAATCCAGAGAAACAAACAACTCGTAGCTTATTTTATGTC[G/A]
GCTTATTATAATCCAGCTATTAGAGTAATCTGATTTAATAATGTATATTAAATTTTAAGCTGAAACAAACAGGGCCTAAGTTTAAACAAACAAGCAGCTT

Reverse complement sequence

AAGCTGCTTGTTTGTTTAAACTTAGGCCCTGTTTGTTTCAGCTTAAAATTTAATATACATTATTAAATCAGATTACTCTAATAGCTGGATTATAATAAGC[C/T]
GACATAAAATAAGCTACGAGTTGTTTGTTTCTCTGGATTATTAGAGGCATCTAAGGGTAGTGGGTCTTTAGCCACTCAATAATCTGAAAAAAGCTCCTCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.80%	1.70%	15.09%	42.42%	NA
All Indica	2759	18.10%	0.40%	21.82%	59.73%	NA
All Japonica	1512	90.40%	1.70%	1.32%	6.61%	NA
Aus	269	7.10%	8.20%	17.10%	67.66%	NA
Indica I	595	16.80%	0.00%	34.79%	48.40%	NA
Indica II	465	19.60%	0.00%	22.58%	57.85%	NA
Indica III	913	16.30%	0.50%	13.25%	69.88%	NA
Indica Intermediate	786	20.20%	0.60%	21.50%	57.63%	NA
Temperate Japonica	767	97.40%	0.00%	0.91%	1.69%	NA
Tropical Japonica	504	79.20%	4.40%	2.18%	14.29%	NA
Japonica Intermediate	241	91.70%	1.20%	0.83%	6.22%	NA
VI/Aromatic	96	2.10%	22.90%	28.12%	46.88%	NA
Intermediate	90	43.30%	3.30%	20.00%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613494920	G -> A	LOC_Os06g23140.1	upstream_gene_variant ; 3752.0bp to feature; MODIFIER	silent_mutation	Average:18.947; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0613494920	G -> A	LOC_Os06g23130.1	downstream_gene_variant ; 3973.0bp to feature; MODIFIER	silent_mutation	Average:18.947; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0613494920	G -> A	LOC_Os06g23130-LOC_Os06g23140	intergenic_region ; MODIFIER	silent_mutation	Average:18.947; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0613494920	G -> DEL	N	N	silent_mutation	Average:18.947; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613494920	3.45E-17	9.02E-87	mr1033	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613494920	9.41E-11	5.05E-17	mr1033	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613494920	4.28E-10	1.71E-46	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613494920	1.13E-07	6.58E-11	mr1176	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613494920	1.10E-07	1.10E-07	mr1536	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613494920	1.53E-25	6.53E-122	mr1033_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613494920	5.39E-14	7.25E-28	mr1033_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613494920	2.54E-10	NA	mr1536_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613494920	1.58E-13	8.61E-16	mr1536_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613494920	NA	7.53E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251