\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613453861:

Variant ID: vg0613453861 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13453861
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGTTGTCTCGGCCGTTTGCTGTTTGGGGGCTTGACATGGTCGGCCCGTTTAAAAAGGCAGTTGGCGGTTATACTCATCTCTTTGTAGCTGTTGACAAAT[C/T]
CTCCAAGTGGATTGAAGCTAAACCGGTTATCACAATCACGGCAGATAAGGCTAGAGATTTTTTCATCAACATTGTGCACCGGTTTGGGGTGCCCAATCGG

Reverse complement sequence

CCGATTGGGCACCCCAAACCGGTGCACAATGTTGATGAAAAAATCTCTAGCCTTATCTGCCGTGATTGTGATAACCGGTTTAGCTTCAATCCACTTGGAG[G/A]
ATTTGTCAACAGCTACAAAGAGATGAGTATAACCGCCAACTGCCTTTTTAAACGGGCCGACCATGTCAAGCCCCCAAACAGCAAACGGCCGAGACAACGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.20% 30.80% 0.02% 0.00% NA
All Indica  2759 97.60% 2.40% 0.04% 0.00% NA
All Japonica  1512 10.40% 89.60% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 97.50% 2.50% 0.00% 0.00% NA
Indica II  465 96.80% 3.00% 0.22% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 95.90% 4.10% 0.00% 0.00% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 21.40% 78.60% 0.00% 0.00% NA
Japonica Intermediate  241 8.30% 91.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613453861 C -> T LOC_Os06g23070.1 downstream_gene_variant ; 464.0bp to feature; MODIFIER silent_mutation Average:43.021; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 N N N N
vg0613453861 C -> T LOC_Os06g23080.1 downstream_gene_variant ; 1110.0bp to feature; MODIFIER silent_mutation Average:43.021; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 N N N N
vg0613453861 C -> T LOC_Os06g23070-LOC_Os06g23080 intergenic_region ; MODIFIER silent_mutation Average:43.021; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613453861 4.80E-26 1.82E-93 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 4.51E-15 1.12E-20 mr1033 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 NA 4.56E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 NA 3.63E-69 mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 1.61E-17 5.45E-51 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 1.19E-10 6.47E-14 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 NA 2.64E-55 mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 NA 6.11E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 NA 1.27E-17 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 1.84E-10 2.29E-74 mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 1.61E-09 1.61E-09 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 NA 2.96E-37 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 NA 2.03E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 NA 1.85E-33 mr1780 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 3.06E-31 3.35E-128 mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 4.38E-15 1.02E-24 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 NA 7.96E-20 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 2.16E-12 4.79E-95 mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 2.78E-10 3.82E-12 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861 NA 7.11E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251