Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613453861:

Variant ID: vg0613453861 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13453861
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGTTGTCTCGGCCGTTTGCTGTTTGGGGGCTTGACATGGTCGGCCCGTTTAAAAAGGCAGTTGGCGGTTATACTCATCTCTTTGTAGCTGTTGACAAAT[C/T]
CTCCAAGTGGATTGAAGCTAAACCGGTTATCACAATCACGGCAGATAAGGCTAGAGATTTTTTCATCAACATTGTGCACCGGTTTGGGGTGCCCAATCGG

Reverse complement sequence

CCGATTGGGCACCCCAAACCGGTGCACAATGTTGATGAAAAAATCTCTAGCCTTATCTGCCGTGATTGTGATAACCGGTTTAGCTTCAATCCACTTGGAG[G/A]
ATTTGTCAACAGCTACAAAGAGATGAGTATAACCGCCAACTGCCTTTTTAAACGGGCCGACCATGTCAAGCCCCCAAACAGCAAACGGCCGAGACAACGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.20%	30.80%	0.02%	0.00%	NA
All Indica	2759	97.60%	2.40%	0.04%	0.00%	NA
All Japonica	1512	10.40%	89.60%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	97.50%	2.50%	0.00%	0.00%	NA
Indica II	465	96.80%	3.00%	0.22%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	95.90%	4.10%	0.00%	0.00%	NA
Temperate Japonica	767	3.80%	96.20%	0.00%	0.00%	NA
Tropical Japonica	504	21.40%	78.60%	0.00%	0.00%	NA
Japonica Intermediate	241	8.30%	91.70%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613453861	C -> T	LOC_Os06g23070.1	downstream_gene_variant ; 464.0bp to feature; MODIFIER	silent_mutation	Average:43.021; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	N	N	N	N
vg0613453861	C -> T	LOC_Os06g23080.1	downstream_gene_variant ; 1110.0bp to feature; MODIFIER	silent_mutation	Average:43.021; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	N	N	N	N
vg0613453861	C -> T	LOC_Os06g23070-LOC_Os06g23080	intergenic_region ; MODIFIER	silent_mutation	Average:43.021; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613453861	4.80E-26	1.82E-93	mr1033	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	4.51E-15	1.12E-20	mr1033	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	NA	4.56E-07	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	NA	3.63E-69	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	1.61E-17	5.45E-51	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	1.19E-10	6.47E-14	mr1176	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	NA	2.64E-55	mr1178	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	NA	6.11E-15	mr1276	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	NA	1.27E-17	mr1529	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	1.84E-10	2.29E-74	mr1536	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	1.61E-09	1.61E-09	mr1536	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	NA	2.96E-37	mr1719	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	NA	2.03E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	NA	1.85E-33	mr1780	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	3.06E-31	3.35E-128	mr1033_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	4.38E-15	1.02E-24	mr1033_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	NA	7.96E-20	mr1276_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	2.16E-12	4.79E-95	mr1536_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	2.78E-10	3.82E-12	mr1536_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613453861	NA	7.11E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251