\
| Variant ID: vg0613452716 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13452716 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 313. )
CTAGATATCCTCAGGTTCAAAAGCTATTATATGGCGTCTTAATTACCGTCAGGAAGCTATCTCACTACTTACAAGGTCACTTGGTTACGGTGGTCACATC[G/A]
TTTCCACTCGGCGATATACTTCATAATCGCGAAGTAAATGGGCGGATCGCAAAATGGGCCTTAGAACTGATGTCCTTGGATATATCGTTCAAGCCGCGAA
TTCGCGGCTTGAACGATATATCCAAGGACATCAGTTCTAAGGCCCATTTTGCGATCCGCCCATTTACTTCGCGATTATGAAGTATATCGCCGAGTGGAAA[C/T]
GATGTGACCACCGTAACCAAGTGACCTTGTAAGTAGTGAGATAGCTTCCTGACGGTAATTAAGACGCCATATAATAGCTTTTGAACCTGAGGATATCTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.50% | 5.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.50% | 7.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 53.20% | 46.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 80.60% | 19.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613452716 | G -> A | LOC_Os06g23070.1 | synonymous_variant ; p.Ser927Ser; LOW | synonymous_codon | Average:55.283; most accessible tissue: Minghui63 flag leaf, score: 82.975 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613452716 | 5.48E-11 | NA | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452716 | 7.31E-13 | 4.27E-17 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452716 | 2.49E-07 | 3.58E-11 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452716 | NA | 2.84E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452716 | NA | 3.04E-06 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452716 | NA | 7.66E-09 | mr1608 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452716 | 1.75E-18 | NA | mr1033_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452716 | 1.55E-16 | 1.09E-22 | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452716 | 8.95E-06 | NA | mr1536_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452716 | 9.54E-08 | 2.99E-09 | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |