\
| Variant ID: vg0613449469 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13449469 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 286. )
ACTCTCCTCGACACCCTCCTCAAGGAAGACGCACTCAACCAAGCTGATCACGTCGTCAACATCTTGAACCAGACCAAGACCATGATTGCCGCCTCGGTCC[C/T]
GGTTAACTCCGCCAGCGTCCGCACGCCGACTTGCAGCCGAGTTCCCCATCTTCGATCTCAAGATTATCACCAGCCAAGTCTCAGCATCGCCGGAGCGGGA
TCCCGCTCCGGCGATGCTGAGACTTGGCTGGTGATAATCTTGAGATCGAAGATGGGGAACTCGGCTGCAAGTCGGCGTGCGGACGCTGGCGGAGTTAACC[G/A]
GGACCGAGGCGGCAATCATGGTCTTGGTCTGGTTCAAGATGTTGACGACGTGATCAGCTTGGTTGAGTGCGTCTTCCTTGAGGAGGGTGTCGAGGAGAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.80% | 5.10% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.50% | 7.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 57.20% | 42.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 80.60% | 19.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 6.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613449469 | C -> T | LOC_Os06g23070.1 | missense_variant&splice_region_variant ; p.Pro326Leu; MODERATE | nonsynonymous_codon ; P326L | Average:53.195; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 | unknown | unknown | DELETERIOUS | 0.04 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613449469 | 1.96E-11 | NA | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613449469 | 7.31E-13 | 4.27E-17 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613449469 | 2.49E-07 | 3.58E-11 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613449469 | 8.91E-07 | NA | mr1536 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613449469 | 2.18E-14 | NA | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613449469 | 1.55E-16 | 1.09E-22 | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613449469 | 9.54E-08 | 2.99E-09 | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |