Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613389030:

Variant ID: vg0613389030 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13389030
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

ATACTCTACTTCTAATATTCCTTATTTTTAATTCCAAGTTTATATTATTTCCTAATTGTATTTCTATATGGACTCTATACTCTACTTCTAATATTCCTTA[C/T]
TTTTAATTCCGAATTTCAGTTATTTCCTAATTATATTTCTATATGGACTCTATACTCTACTTCTAATATTCCTTATTTTTAATTCCGAATTTCAGTTATT

Reverse complement sequence

AATAACTGAAATTCGGAATTAAAAATAAGGAATATTAGAAGTAGAGTATAGAGTCCATATAGAAATATAATTAGGAAATAACTGAAATTCGGAATTAAAA[G/A]
TAAGGAATATTAGAAGTAGAGTATAGAGTCCATATAGAAATACAATTAGGAAATAATATAAACTTGGAATTAAAAATAAGGAATATTAGAAGTAGAGTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.40%	1.10%	10.88%	55.67%	NA
All Indica	2759	4.20%	1.10%	7.18%	87.53%	NA
All Japonica	1512	90.60%	0.30%	6.48%	2.58%	NA
Aus	269	1.50%	5.20%	44.61%	48.70%	NA
Indica I	595	5.40%	1.20%	11.43%	82.02%	NA
Indica II	465	4.90%	0.20%	2.15%	92.69%	NA
Indica III	913	1.90%	1.00%	5.04%	92.11%	NA
Indica Intermediate	786	5.50%	1.80%	9.41%	83.33%	NA
Temperate Japonica	767	96.50%	0.10%	0.13%	3.26%	NA
Tropical Japonica	504	81.00%	0.80%	16.47%	1.79%	NA
Japonica Intermediate	241	92.10%	0.00%	5.81%	2.07%	NA
VI/Aromatic	96	2.10%	0.00%	85.42%	12.50%	NA
Intermediate	90	44.40%	0.00%	17.78%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613389030	C -> T	LOC_Os06g22940.1	downstream_gene_variant ; 2483.0bp to feature; MODIFIER	silent_mutation	Average:9.648; most accessible tissue: Zhenshan97 root, score: 18.731	N	N	N	N
vg0613389030	C -> T	LOC_Os06g22919.1	intron_variant ; MODIFIER	silent_mutation	Average:9.648; most accessible tissue: Zhenshan97 root, score: 18.731	N	N	N	N
vg0613389030	C -> T	LOC_Os06g22919.3	intron_variant ; MODIFIER	silent_mutation	Average:9.648; most accessible tissue: Zhenshan97 root, score: 18.731	N	N	N	N
vg0613389030	C -> T	LOC_Os06g22919.4	intron_variant ; MODIFIER	silent_mutation	Average:9.648; most accessible tissue: Zhenshan97 root, score: 18.731	N	N	N	N
vg0613389030	C -> T	LOC_Os06g22919.2	intron_variant ; MODIFIER	silent_mutation	Average:9.648; most accessible tissue: Zhenshan97 root, score: 18.731	N	N	N	N
vg0613389030	C -> DEL	N	N	silent_mutation	Average:9.648; most accessible tissue: Zhenshan97 root, score: 18.731	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613389030	3.02E-14	5.15E-83	mr1033	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	2.18E-07	6.08E-13	mr1033	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	2.74E-11	3.17E-16	mr1033	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	NA	3.86E-07	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	NA	4.22E-07	mr1076	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	NA	3.36E-07	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	NA	2.26E-06	mr1145	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	1.47E-11	3.31E-47	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	2.56E-06	7.67E-11	mr1176	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	8.60E-08	1.32E-10	mr1176	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	NA	9.26E-11	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	NA	2.30E-10	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	NA	1.26E-06	mr1436	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	NA	7.19E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	3.52E-08	3.52E-08	mr1536	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	NA	3.52E-08	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	1.47E-15	1.80E-110	mr1033_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	NA	1.38E-16	mr1033_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	1.67E-13	1.35E-21	mr1033_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	NA	8.31E-19	mr1165_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	NA	2.71E-20	mr1276_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	6.66E-07	NA	mr1536_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	4.78E-09	1.09E-10	mr1536_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	NA	9.30E-08	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613389030	NA	7.25E-08	mr1993_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251