\
| Variant ID: vg0613374729 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13374729 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACCAAGTCTCAATTTACTTTTATGGAATAATAGATTAAGCATGTCCATGTAAAATACATTGTTATACAAATAAACTCGACCAATGTGCTATTGTATTATT[G/A]
AAGGTCACATTAGTATATTTAATTAGTTTTTAAGAAATATCAAAGCCTAGAAGTTATATTGGATAATTTTTGGATAATCTAAAGGAAAGCAAATTCATTT
AAATGAATTTGCTTTCCTTTAGATTATCCAAAAATTATCCAATATAACTTCTAGGCTTTGATATTTCTTAAAAACTAATTAAATATACTAATGTGACCTT[C/T]
AATAATACAATAGCACATTGGTCGAGTTTATTTGTATAACAATGTATTTTACATGGACATGCTTAATCTATTATTCCATAAAAGTAAATTGAGACTTGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.10% | 31.90% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 18.70% | 81.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.90% | 92.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 37.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613374729 | G -> A | LOC_Os06g22919.1 | upstream_gene_variant ; 774.0bp to feature; MODIFIER | silent_mutation | Average:48.72; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg0613374729 | G -> A | LOC_Os06g22919.3 | upstream_gene_variant ; 774.0bp to feature; MODIFIER | silent_mutation | Average:48.72; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg0613374729 | G -> A | LOC_Os06g22919.4 | upstream_gene_variant ; 774.0bp to feature; MODIFIER | silent_mutation | Average:48.72; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg0613374729 | G -> A | LOC_Os06g22925.1 | downstream_gene_variant ; 4666.0bp to feature; MODIFIER | silent_mutation | Average:48.72; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg0613374729 | G -> A | LOC_Os06g22900.1 | intron_variant ; MODIFIER | silent_mutation | Average:48.72; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613374729 | 8.13E-13 | 4.00E-77 | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | 3.14E-06 | 5.64E-10 | mr1033 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | 2.74E-11 | 3.17E-16 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | 6.44E-06 | 8.86E-09 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | 1.49E-06 | 2.65E-08 | mr1083 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | NA | 6.99E-06 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | NA | 6.32E-07 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | NA | 8.77E-06 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | NA | 4.91E-06 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | NA | 4.93E-13 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | NA | 2.57E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | 4.11E-10 | 1.19E-44 | mr1176 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | NA | 2.78E-07 | mr1176 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | 8.60E-08 | 1.32E-10 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | 8.12E-07 | 9.99E-09 | mr1204 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | NA | 1.12E-14 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | NA | 1.01E-35 | mr1402 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | NA | 2.66E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | NA | 2.09E-07 | mr1436 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | NA | 1.58E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | 3.52E-08 | 3.52E-08 | mr1536 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | NA | 1.96E-06 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | 6.92E-13 | 1.29E-99 | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | NA | 6.68E-12 | mr1033_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | 1.67E-13 | 1.35E-21 | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | NA | 1.07E-19 | mr1276_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | 3.91E-07 | NA | mr1536_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613374729 | 4.78E-09 | 1.09E-10 | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |