\
| Variant ID: vg0613339384 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13339384 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 281. )
TGGGGCCCATTCATCAAAAAGCGACGGGGCATTCCATACCTAACCTCTGTGAGGGTCCACTTGTAAAAAATGGTTACTATTTAATCCTCCATGACTATAA[G/A]
GGGATTAGTGGAGGATCAATCCACTAAAGAGAGGATCTGGATAGAACGTAGAATTTAGTTAAGGAAATCTAGCCCTTGTAGCCAATTGATTCGACCACAT
ATGTGGTCGAATCAATTGGCTACAAGGGCTAGATTTCCTTAACTAAATTCTACGTTCTATCCAGATCCTCTCTTTAGTGGATTGATCCTCCACTAATCCC[C/T]
TTATAGTCATGGAGGATTAAATAGTAACCATTTTTTACAAGTGGACCCTCACAGAGGTTAGGTATGGAATGCCCCGTCGCTTTTTGATGAATGGGCCCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.10% | 9.40% | 1.42% | 0.00% | NA |
| All Indica | 2759 | 82.30% | 15.30% | 2.39% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 94.80% | 0.50% | 4.71% | 0.00% | NA |
| Indica II | 465 | 85.80% | 12.00% | 2.15% | 0.00% | NA |
| Indica III | 913 | 69.10% | 30.20% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 86.10% | 11.10% | 2.80% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613339384 | G -> A | LOC_Os06g22860.1 | downstream_gene_variant ; 2029.0bp to feature; MODIFIER | silent_mutation | Average:55.265; most accessible tissue: Zhenshan97 young leaf, score: 73.54 | N | N | N | N |
| vg0613339384 | G -> A | LOC_Os06g22860-LOC_Os06g22870 | intergenic_region ; MODIFIER | silent_mutation | Average:55.265; most accessible tissue: Zhenshan97 young leaf, score: 73.54 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613339384 | 6.38E-06 | NA | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613339384 | 5.11E-07 | NA | mr1096 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613339384 | 6.29E-07 | NA | mr1111 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613339384 | 7.70E-07 | NA | mr1121 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613339384 | 3.07E-07 | NA | mr1144 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613339384 | 7.20E-06 | NA | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613339384 | 3.66E-06 | NA | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613339384 | 3.24E-06 | NA | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613339384 | 1.01E-06 | NA | mr1111_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613339384 | 2.89E-06 | NA | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613339384 | 3.28E-07 | NA | mr1121_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613339384 | 2.69E-06 | 4.32E-06 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613339384 | 3.46E-06 | NA | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613339384 | 9.94E-06 | NA | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613339384 | 5.71E-06 | NA | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |