\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613280290:

Variant ID: vg0613280290 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13280290
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAATTCGTATTTTCATTGTTGTTAGATGATAAAACATGATTAATATTTTATGCGTGACTTGTCTTTTTAATTTTTTTTATAGTTTTTTTAAATAAGACG[G/A]
ACGGTCAAACGTTGGGCACGGAAACCAGGTTTGTCTTTTTTTTTTTGACCGGGGGAGTATGTATTTGTCATCCAACGCGACACACAAGCATAATACATGG

Reverse complement sequence

CCATGTATTATGCTTGTGTGTCGCGTTGGATGACAAATACATACTCCCCCGGTCAAAAAAAAAAAGACAAACCTGGTTTCCGTGCCCAACGTTTGACCGT[C/T]
CGTCTTATTTAAAAAAACTATAAAAAAAATTAAAAAGACAAGTCACGCATAAAATATTAATCATGTTTTATCATCTAACAACAATGAAAATACGAATTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 0.60% 5.86% 0.53% NA
All Indica  2759 99.10% 0.10% 0.69% 0.14% NA
All Japonica  1512 80.10% 1.80% 16.80% 1.32% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.60% 0.00% 1.94% 0.43% NA
Indica III  913 99.70% 0.00% 0.33% 0.00% NA
Indica Intermediate  786 98.60% 0.30% 0.89% 0.25% NA
Temperate Japonica  767 98.40% 0.10% 1.43% 0.00% NA
Tropical Japonica  504 49.80% 4.80% 42.06% 3.37% NA
Japonica Intermediate  241 85.10% 0.80% 12.86% 1.24% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 0.00% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613280290 G -> A LOC_Os06g22800.1 upstream_gene_variant ; 988.0bp to feature; MODIFIER silent_mutation Average:80.661; most accessible tissue: Minghui63 root, score: 93.961 N N N N
vg0613280290 G -> A LOC_Os06g22800-LOC_Os06g22810 intergenic_region ; MODIFIER silent_mutation Average:80.661; most accessible tissue: Minghui63 root, score: 93.961 N N N N
vg0613280290 G -> DEL N N silent_mutation Average:80.661; most accessible tissue: Minghui63 root, score: 93.961 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613280290 1.06E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613280290 9.36E-08 NA mr1082 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613280290 1.00E-07 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613280290 NA 3.89E-20 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613280290 NA 5.39E-08 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613280290 3.94E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613280290 1.90E-08 NA mr1560 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613280290 NA 2.97E-08 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613280290 NA 1.26E-19 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251