Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0613280290:

Variant ID: vg0613280290 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13280290
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAATTCGTATTTTCATTGTTGTTAGATGATAAAACATGATTAATATTTTATGCGTGACTTGTCTTTTTAATTTTTTTTATAGTTTTTTTAAATAAGACG[G/A]
ACGGTCAAACGTTGGGCACGGAAACCAGGTTTGTCTTTTTTTTTTTGACCGGGGGAGTATGTATTTGTCATCCAACGCGACACACAAGCATAATACATGG

Reverse complement sequence

CCATGTATTATGCTTGTGTGTCGCGTTGGATGACAAATACATACTCCCCCGGTCAAAAAAAAAAAGACAAACCTGGTTTCCGTGCCCAACGTTTGACCGT[C/T]
CGTCTTATTTAAAAAAACTATAAAAAAAATTAAAAAGACAAGTCACGCATAAAATATTAATCATGTTTTATCATCTAACAACAATGAAAATACGAATTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.00%	0.60%	5.86%	0.53%	NA
All Indica	2759	99.10%	0.10%	0.69%	0.14%	NA
All Japonica	1512	80.10%	1.80%	16.80%	1.32%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.60%	0.00%	1.94%	0.43%	NA
Indica III	913	99.70%	0.00%	0.33%	0.00%	NA
Indica Intermediate	786	98.60%	0.30%	0.89%	0.25%	NA
Temperate Japonica	767	98.40%	0.10%	1.43%	0.00%	NA
Tropical Japonica	504	49.80%	4.80%	42.06%	3.37%	NA
Japonica Intermediate	241	85.10%	0.80%	12.86%	1.24%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	0.00%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613280290	G -> A	LOC_Os06g22800.1	upstream_gene_variant ; 988.0bp to feature; MODIFIER	silent_mutation	Average:80.661; most accessible tissue: Minghui63 root, score: 93.961	N	N	N	N
vg0613280290	G -> A	LOC_Os06g22800-LOC_Os06g22810	intergenic_region ; MODIFIER	silent_mutation	Average:80.661; most accessible tissue: Minghui63 root, score: 93.961	N	N	N	N
vg0613280290	G -> DEL	N	N	silent_mutation	Average:80.661; most accessible tissue: Minghui63 root, score: 93.961	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613280290	1.06E-06	NA	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613280290	9.36E-08	NA	mr1082	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613280290	1.00E-07	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613280290	NA	3.89E-20	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613280290	NA	5.39E-08	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613280290	3.94E-06	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613280290	1.90E-08	NA	mr1560	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613280290	NA	2.97E-08	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613280290	NA	1.26E-19	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251