Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0613133735:

Variant ID: vg0613133735 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13133735
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATATAAAGTAGTATCGGAGTATTAGCCGATACATGCTAGATCTATCTGATCGGCTATGCTATAAACATATATAATCATGTTATTAATATATATTTCGATC[T/A]
AAGTGATTTATACTGTCTTGGCATGGTGACCGATCTATCTCAAACACTTGATTTAAGTATATATTAATATAAGAACTATATATCGTTAATATCTACAGCC

Reverse complement sequence

GGCTGTAGATATTAACGATATATAGTTCTTATATTAATATATACTTAAATCAAGTGTTTGAGATAGATCGGTCACCATGCCAAGACAGTATAAATCACTT[A/T]
GATCGAAATATATATTAATAACATGATTATATATGTTTATAGCATAGCCGATCAGATAGATCTAGCATGTATCGGCTAATACTCCGATACTACTTTATAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.80%	31.10%	0.08%	0.00%	NA
All Indica	2759	97.30%	2.60%	0.07%	0.00%	NA
All Japonica	1512	9.70%	90.10%	0.13%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	97.10%	2.90%	0.00%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	99.30%	0.50%	0.11%	0.00%	NA
Indica Intermediate	786	95.40%	4.50%	0.13%	0.00%	NA
Temperate Japonica	767	3.70%	96.30%	0.00%	0.00%	NA
Tropical Japonica	504	19.60%	80.20%	0.20%	0.00%	NA
Japonica Intermediate	241	8.30%	91.30%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	64.40%	35.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613133735	T -> A	LOC_Os06g22580.1	upstream_gene_variant ; 1534.0bp to feature; MODIFIER	silent_mutation	Average:16.308; most accessible tissue: Zhenshan97 root, score: 22.162	N	N	N	N
vg0613133735	T -> A	LOC_Os06g22590.1	downstream_gene_variant ; 3182.0bp to feature; MODIFIER	silent_mutation	Average:16.308; most accessible tissue: Zhenshan97 root, score: 22.162	N	N	N	N
vg0613133735	T -> A	LOC_Os06g22560-LOC_Os06g22580	intergenic_region ; MODIFIER	silent_mutation	Average:16.308; most accessible tissue: Zhenshan97 root, score: 22.162	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613133735	NA	1.40E-21	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	6.02E-14	6.29E-81	mr1033	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	2.74E-11	3.17E-16	mr1033	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	NA	3.50E-68	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	NA	2.59E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	4.09E-07	1.73E-41	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	8.60E-08	1.32E-10	mr1176	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	NA	3.11E-55	mr1178	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	NA	1.03E-27	mr1223	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	NA	2.40E-07	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	NA	1.53E-17	mr1276	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	NA	3.96E-21	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	NA	4.44E-19	mr1529	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	3.52E-08	3.52E-08	mr1536	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	NA	4.24E-15	mr1950	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	NA	5.13E-21	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	3.66E-14	1.07E-111	mr1033_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	1.67E-13	1.35E-21	mr1033_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	NA	5.01E-19	mr1276_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	4.78E-09	1.09E-10	mr1536_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133735	NA	2.38E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251