\
| Variant ID: vg0613133735 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13133735 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATATAAAGTAGTATCGGAGTATTAGCCGATACATGCTAGATCTATCTGATCGGCTATGCTATAAACATATATAATCATGTTATTAATATATATTTCGATC[T/A]
AAGTGATTTATACTGTCTTGGCATGGTGACCGATCTATCTCAAACACTTGATTTAAGTATATATTAATATAAGAACTATATATCGTTAATATCTACAGCC
GGCTGTAGATATTAACGATATATAGTTCTTATATTAATATATACTTAAATCAAGTGTTTGAGATAGATCGGTCACCATGCCAAGACAGTATAAATCACTT[A/T]
GATCGAAATATATATTAATAACATGATTATATATGTTTATAGCATAGCCGATCAGATAGATCTAGCATGTATCGGCTAATACTCCGATACTACTTTATAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.80% | 31.10% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 97.30% | 2.60% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 9.70% | 90.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.40% | 4.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 19.60% | 80.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 8.30% | 91.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 35.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613133735 | T -> A | LOC_Os06g22580.1 | upstream_gene_variant ; 1534.0bp to feature; MODIFIER | silent_mutation | Average:16.308; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
| vg0613133735 | T -> A | LOC_Os06g22590.1 | downstream_gene_variant ; 3182.0bp to feature; MODIFIER | silent_mutation | Average:16.308; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
| vg0613133735 | T -> A | LOC_Os06g22560-LOC_Os06g22580 | intergenic_region ; MODIFIER | silent_mutation | Average:16.308; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613133735 | NA | 1.40E-21 | mr1020 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | 6.02E-14 | 6.29E-81 | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | 2.74E-11 | 3.17E-16 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | NA | 3.50E-68 | mr1132 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | NA | 2.59E-11 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | 4.09E-07 | 1.73E-41 | mr1176 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | 8.60E-08 | 1.32E-10 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | NA | 3.11E-55 | mr1178 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | NA | 1.03E-27 | mr1223 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | NA | 2.40E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | NA | 1.53E-17 | mr1276 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | NA | 3.96E-21 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | NA | 4.44E-19 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | 3.52E-08 | 3.52E-08 | mr1536 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | NA | 4.24E-15 | mr1950 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | NA | 5.13E-21 | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | 3.66E-14 | 1.07E-111 | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | 1.67E-13 | 1.35E-21 | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | NA | 5.01E-19 | mr1276_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | 4.78E-09 | 1.09E-10 | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613133735 | NA | 2.38E-14 | mr1950_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |