\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613063833:

Variant ID: vg0613063833 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13063833
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


TTATTATTCTTTGACATATCCAGTCCATAGCCGATTTGGTCTAACTTCATCTGTTTAGACCATCAACGATATGCTATCGGCCTATCGGCCGATCGGCTAT[C/T]
GGTCGACTGATTCTGCTTTTATTCTTTCTTGCTGATTGCAGAATCAAATCAACTAGCATGCCCTTGACACACTTGAGGCTAGCCTTGGACCTACACTGGA

Reverse complement sequence

TCCAGTGTAGGTCCAAGGCTAGCCTCAAGTGTGTCAAGGGCATGCTAGTTGATTTGATTCTGCAATCAGCAAGAAAGAATAAAAGCAGAATCAGTCGACC[G/A]
ATAGCCGATCGGCCGATAGGCCGATAGCATATCGTTGATGGTCTAAACAGATGAAGTTAGACCAAATCGGCTATGGACTGGATATGTCAAAGAATAATAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 42.50% 1.93% 4.49% NA
All Indica  2759 78.20% 11.30% 3.04% 7.39% NA
All Japonica  1512 2.70% 97.10% 0.07% 0.13% NA
Aus  269 53.20% 46.10% 0.74% 0.00% NA
Indica I  595 77.00% 9.70% 6.22% 7.06% NA
Indica II  465 81.50% 6.00% 2.80% 9.68% NA
Indica III  913 78.40% 13.90% 0.88% 6.79% NA
Indica Intermediate  786 77.00% 12.70% 3.31% 7.00% NA
Temperate Japonica  767 3.40% 96.30% 0.00% 0.26% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.30% 0.41% 0.00% NA
VI/Aromatic  96 31.20% 63.50% 2.08% 3.12% NA
Intermediate  90 46.70% 47.80% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613063833 C -> T LOC_Os06g22470.1 upstream_gene_variant ; 1627.0bp to feature; MODIFIER silent_mutation Average:40.956; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0613063833 C -> T LOC_Os06g22480.1 upstream_gene_variant ; 185.0bp to feature; MODIFIER silent_mutation Average:40.956; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0613063833 C -> T LOC_Os06g22470-LOC_Os06g22480 intergenic_region ; MODIFIER silent_mutation Average:40.956; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0613063833 C -> DEL N N silent_mutation Average:40.956; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613063833 6.52E-06 NA mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613063833 9.24E-07 NA mr1108 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613063833 4.58E-06 NA mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613063833 3.44E-06 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613063833 5.39E-06 NA mr1112 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613063833 3.88E-07 NA mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613063833 4.23E-07 NA mr1121 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613063833 1.78E-07 NA mr1144 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613063833 2.31E-06 NA mr1234 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613063833 NA 9.56E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613063833 NA 1.23E-12 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613063833 NA 6.53E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613063833 NA 2.27E-11 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613063833 NA 5.21E-10 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613063833 NA 4.36E-06 mr1656 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613063833 NA 1.01E-06 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613063833 NA 1.03E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613063833 NA 9.48E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251