\
| Variant ID: vg0612638166 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 12638166 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, G: 0.09, others allele: 0.00, population size: 90. )
ATAGATTTTCCTTTTTAGCTTTTTAGCGTTCATGTAATTTTATTTTCTTTCATGTTGGAATTCCTAATCAGGGGTTTTCTCTACGGAGATGTAATTAACA[T/G]
AATTTATATGTAAATGTATGAATTTTGGAAGTAATGGACTCGCAATTTCTGATTTTTATTTATTTATTGCATTTAAATTAAATTGTCTCTAACGATTTGC
GCAAATCGTTAGAGACAATTTAATTTAAATGCAATAAATAAATAAAAATCAGAAATTGCGAGTCCATTACTTCCAAAATTCATACATTTACATATAAATT[A/C]
TGTTAATTACATCTCCGTAGAGAAAACCCCTGATTAGGAATTCCAACATGAAAGAAAATAAAATTACATGAACGCTAAAAAGCTAAAAAGGAAAATCTAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.30% | 21.00% | 24.61% | 1.10% | NA |
| All Indica | 2759 | 36.60% | 26.10% | 37.19% | 0.11% | NA |
| All Japonica | 1512 | 89.60% | 8.70% | 1.72% | 0.00% | NA |
| Aus | 269 | 15.60% | 41.30% | 25.28% | 17.84% | NA |
| Indica I | 595 | 55.30% | 5.90% | 38.82% | 0.00% | NA |
| Indica II | 465 | 72.00% | 3.70% | 24.30% | 0.00% | NA |
| Indica III | 913 | 5.00% | 53.20% | 41.40% | 0.33% | NA |
| Indica Intermediate | 786 | 38.30% | 23.00% | 38.68% | 0.00% | NA |
| Temperate Japonica | 767 | 97.70% | 0.70% | 1.69% | 0.00% | NA |
| Tropical Japonica | 504 | 76.60% | 21.80% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.90% | 7.10% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 61.50% | 14.60% | 23.96% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 16.70% | 22.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0612638166 | T -> G | LOC_Os06g21870-LOC_Os06g21880 | intergenic_region ; MODIFIER | silent_mutation | Average:33.125; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 | N | N | N | N |
| vg0612638166 | T -> DEL | N | N | silent_mutation | Average:33.125; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0612638166 | NA | 1.58E-06 | mr1020 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612638166 | 6.75E-06 | NA | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612638166 | NA | 6.67E-06 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612638166 | 2.80E-06 | NA | mr1165 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612638166 | NA | 4.20E-06 | mr1177 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612638166 | 2.17E-06 | NA | mr1971 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612638166 | NA | 6.00E-07 | mr1971 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |