\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612546146:

Variant ID: vg0612546146 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12546146
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGTGTACGGTTGCGACGCTCAGCCACTCCATTTTGTTGTGGTTCTCTAGGCATGGAATATTGGGCAATTATTCCATGTATCTGAAGATATTGGGCAAA[T/C]
GGACCAGGACTTTGCCCATAAGGAGTAGGTCTCCCATAATATTCTCCTCCTCGATCTGATCTCACTACTTTAATTTTTGCATTATGTTGATTTTCAACCT

Reverse complement sequence

AGGTTGAAAATCAACATAATGCAAAAATTAAAGTAGTGAGATCAGATCGAGGAGGAGAATATTATGGGAGACCTACTCCTTATGGGCAAAGTCCTGGTCC[A/G]
TTTGCCCAATATCTTCAGATACATGGAATAATTGCCCAATATTCCATGCCTAGAGAACCACAACAAAATGGAGTGGCTGAGCGTCGCAACCGTACACTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.10% 34.50% 8.04% 15.36% NA
All Indica  2759 65.10% 5.40% 5.47% 24.07% NA
All Japonica  1512 3.80% 89.20% 5.89% 1.06% NA
Aus  269 29.00% 12.60% 48.70% 9.67% NA
Indica I  595 37.50% 8.10% 8.91% 45.55% NA
Indica II  465 40.60% 7.10% 7.53% 44.73% NA
Indica III  913 94.50% 1.10% 1.75% 2.63% NA
Indica Intermediate  786 66.30% 7.30% 5.98% 20.48% NA
Temperate Japonica  767 1.00% 97.00% 0.39% 1.56% NA
Tropical Japonica  504 7.30% 77.00% 15.48% 0.20% NA
Japonica Intermediate  241 5.40% 90.00% 3.32% 1.24% NA
VI/Aromatic  96 29.20% 58.30% 4.17% 8.33% NA
Intermediate  90 34.40% 46.70% 5.56% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612546146 T -> C LOC_Os06g21700.1 synonymous_variant ; p.Pro131Pro; LOW synonymous_codon Average:15.869; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0612546146 T -> DEL LOC_Os06g21700.1 N frameshift_variant Average:15.869; most accessible tissue: Minghui63 root, score: 25.504 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612546146 4.99E-07 1.97E-19 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146 3.33E-08 6.43E-17 mr1133 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146 6.06E-06 6.06E-06 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146 4.82E-06 1.20E-10 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146 NA 4.23E-08 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146 2.35E-06 1.53E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146 7.49E-07 1.55E-11 mr1667 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146 NA 3.98E-06 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146 2.75E-10 1.83E-25 mr1133_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146 2.47E-10 7.99E-21 mr1133_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146 NA 1.46E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146 NA 3.61E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146 NA 6.68E-13 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146 1.26E-06 1.02E-12 mr1667_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251