Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612546146:

Variant ID: vg0612546146 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 12546146
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

TAAGTGTACGGTTGCGACGCTCAGCCACTCCATTTTGTTGTGGTTCTCTAGGCATGGAATATTGGGCAATTATTCCATGTATCTGAAGATATTGGGCAAA[T/C]
GGACCAGGACTTTGCCCATAAGGAGTAGGTCTCCCATAATATTCTCCTCCTCGATCTGATCTCACTACTTTAATTTTTGCATTATGTTGATTTTCAACCT

Reverse complement sequence

AGGTTGAAAATCAACATAATGCAAAAATTAAAGTAGTGAGATCAGATCGAGGAGGAGAATATTATGGGAGACCTACTCCTTATGGGCAAAGTCCTGGTCC[A/G]
TTTGCCCAATATCTTCAGATACATGGAATAATTGCCCAATATTCCATGCCTAGAGAACCACAACAAAATGGAGTGGCTGAGCGTCGCAACCGTACACTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.10%	34.50%	8.04%	15.36%	NA
All Indica	2759	65.10%	5.40%	5.47%	24.07%	NA
All Japonica	1512	3.80%	89.20%	5.89%	1.06%	NA
Aus	269	29.00%	12.60%	48.70%	9.67%	NA
Indica I	595	37.50%	8.10%	8.91%	45.55%	NA
Indica II	465	40.60%	7.10%	7.53%	44.73%	NA
Indica III	913	94.50%	1.10%	1.75%	2.63%	NA
Indica Intermediate	786	66.30%	7.30%	5.98%	20.48%	NA
Temperate Japonica	767	1.00%	97.00%	0.39%	1.56%	NA
Tropical Japonica	504	7.30%	77.00%	15.48%	0.20%	NA
Japonica Intermediate	241	5.40%	90.00%	3.32%	1.24%	NA
VI/Aromatic	96	29.20%	58.30%	4.17%	8.33%	NA
Intermediate	90	34.40%	46.70%	5.56%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0612546146	T -> C	LOC_Os06g21700.1	synonymous_variant ; p.Pro131Pro; LOW	synonymous_codon	Average:15.869; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0612546146	T -> DEL	LOC_Os06g21700.1	N	frameshift_variant	Average:15.869; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0612546146	4.99E-07	1.97E-19	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146	3.33E-08	6.43E-17	mr1133	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146	6.06E-06	6.06E-06	mr1540	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146	4.82E-06	1.20E-10	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146	NA	4.23E-08	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146	2.35E-06	1.53E-12	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146	7.49E-07	1.55E-11	mr1667	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146	NA	3.98E-06	mr1732	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146	2.75E-10	1.83E-25	mr1133_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146	2.47E-10	7.99E-21	mr1133_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146	NA	1.46E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146	NA	3.61E-06	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146	NA	6.68E-13	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612546146	1.26E-06	1.02E-12	mr1667_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251