Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0612290452:

Variant ID: vg0612290452 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 12290452
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTGCCCGGCGAGATCAGAGATAACGCTTTCGTCTCTCCTGACAGTATCCGGAGACACCGTAGGGGACTAGTCGTGCTTATCCCTGAAGTCGATATCCGG[T/C]
GTCTTGTCCTGGCGTATGTTGGCTTGTATGTTGATCTTGTGTCTTGATCTATGGTGGGTGTCTGTTGATTGCGTTGGTTGTGTCCCCCCTCTCCTCCTAG

Reverse complement sequence

CTAGGAGGAGAGGGGGGACACAACCAACGCAATCAACAGACACCCACCATAGATCAAGACACAAGATCAACATACAAGCCAACATACGCCAGGACAAGAC[A/G]
CCGGATATCGACTTCAGGGATAAGCACGACTAGTCCCCTACGGTGTCTCCGGATACTGTCAGGAGAGACGAAAGCGTTATCTCTGATCTCGCCGGGCACG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.10%	30.70%	0.23%	0.00%	NA
All Indica	2759	97.30%	2.40%	0.33%	0.00%	NA
All Japonica	1512	12.10%	87.80%	0.07%	0.00%	NA
Aus	269	91.40%	8.60%	0.00%	0.00%	NA
Indica I	595	96.50%	3.00%	0.50%	0.00%	NA
Indica II	465	96.80%	3.00%	0.22%	0.00%	NA
Indica III	913	99.60%	0.30%	0.11%	0.00%	NA
Indica Intermediate	786	95.70%	3.80%	0.51%	0.00%	NA
Temperate Japonica	767	3.00%	96.90%	0.13%	0.00%	NA
Tropical Japonica	504	27.20%	72.80%	0.00%	0.00%	NA
Japonica Intermediate	241	9.50%	90.50%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	66.70%	32.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0612290452	T -> C	LOC_Os06g21250.1	downstream_gene_variant ; 1617.0bp to feature; MODIFIER	silent_mutation	Average:47.193; most accessible tissue: Zhenshan97 flag leaf, score: 58.772	N	N	N	N
vg0612290452	T -> C	LOC_Os06g21260.1	downstream_gene_variant ; 1572.0bp to feature; MODIFIER	silent_mutation	Average:47.193; most accessible tissue: Zhenshan97 flag leaf, score: 58.772	N	N	N	N
vg0612290452	T -> C	LOC_Os06g21250-LOC_Os06g21260	intergenic_region ; MODIFIER	silent_mutation	Average:47.193; most accessible tissue: Zhenshan97 flag leaf, score: 58.772	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0612290452	7.36E-06	9.20E-09	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452	NA	6.56E-06	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452	NA	9.82E-06	mr1085	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452	3.37E-06	NA	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452	NA	2.55E-07	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452	1.01E-08	8.91E-10	mr1107	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452	NA	6.37E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452	2.36E-06	2.36E-06	mr1165	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452	2.07E-06	4.89E-08	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452	NA	7.32E-07	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452	1.95E-06	2.90E-08	mr1560	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452	NA	5.14E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452	NA	5.33E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452	NA	2.67E-08	mr1165_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452	NA	8.94E-19	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251