\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612290452:

Variant ID: vg0612290452 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12290452
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTGCCCGGCGAGATCAGAGATAACGCTTTCGTCTCTCCTGACAGTATCCGGAGACACCGTAGGGGACTAGTCGTGCTTATCCCTGAAGTCGATATCCGG[T/C]
GTCTTGTCCTGGCGTATGTTGGCTTGTATGTTGATCTTGTGTCTTGATCTATGGTGGGTGTCTGTTGATTGCGTTGGTTGTGTCCCCCCTCTCCTCCTAG

Reverse complement sequence

CTAGGAGGAGAGGGGGGACACAACCAACGCAATCAACAGACACCCACCATAGATCAAGACACAAGATCAACATACAAGCCAACATACGCCAGGACAAGAC[A/G]
CCGGATATCGACTTCAGGGATAAGCACGACTAGTCCCCTACGGTGTCTCCGGATACTGTCAGGAGAGACGAAAGCGTTATCTCTGATCTCGCCGGGCACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 30.70% 0.23% 0.00% NA
All Indica  2759 97.30% 2.40% 0.33% 0.00% NA
All Japonica  1512 12.10% 87.80% 0.07% 0.00% NA
Aus  269 91.40% 8.60% 0.00% 0.00% NA
Indica I  595 96.50% 3.00% 0.50% 0.00% NA
Indica II  465 96.80% 3.00% 0.22% 0.00% NA
Indica III  913 99.60% 0.30% 0.11% 0.00% NA
Indica Intermediate  786 95.70% 3.80% 0.51% 0.00% NA
Temperate Japonica  767 3.00% 96.90% 0.13% 0.00% NA
Tropical Japonica  504 27.20% 72.80% 0.00% 0.00% NA
Japonica Intermediate  241 9.50% 90.50% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 66.70% 32.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612290452 T -> C LOC_Os06g21250.1 downstream_gene_variant ; 1617.0bp to feature; MODIFIER silent_mutation Average:47.193; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 N N N N
vg0612290452 T -> C LOC_Os06g21260.1 downstream_gene_variant ; 1572.0bp to feature; MODIFIER silent_mutation Average:47.193; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 N N N N
vg0612290452 T -> C LOC_Os06g21250-LOC_Os06g21260 intergenic_region ; MODIFIER silent_mutation Average:47.193; most accessible tissue: Zhenshan97 flag leaf, score: 58.772 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612290452 7.36E-06 9.20E-09 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452 NA 6.56E-06 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452 NA 9.82E-06 mr1085 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452 3.37E-06 NA mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452 NA 2.55E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452 1.01E-08 8.91E-10 mr1107 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452 NA 6.37E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452 2.36E-06 2.36E-06 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452 2.07E-06 4.89E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452 NA 7.32E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452 1.95E-06 2.90E-08 mr1560 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452 NA 5.14E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452 NA 5.33E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452 NA 2.67E-08 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612290452 NA 8.94E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251