\
| Variant ID: vg0612288311 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 12288311 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 286. )
GCAGAAGCTAAGGGGAAGAACATGGAACCGGAAGTAGTCCATGTCCCTCAAGATGAGAAGATAGCATACCATGGTGATGGATATGGACATGGAGGAGGCT[A/T]
TGGTGGCGGTTATGGATCTGGGTACGGCGGAGGAAATGGTGGTGGGTATGGTGGTGGATATGGCGGCTACGGTGGTGGATATGGTGGAGGATATGGTGGT
ACCACCATATCCTCCACCATATCCACCACCGTAGCCGCCATATCCACCACCATACCCACCACCATTTCCTCCGCCGTACCCAGATCCATAACCGCCACCA[T/A]
AGCCTCCTCCATGTCCATATCCATCACCATGGTATGCTATCTTCTCATCTTGAGGGACATGGACTACTTCCGGTTCCATGTTCTTCCCCTTAGCTTCTGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.80% | 9.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0612288311 | A -> T | LOC_Os06g21250.1 | missense_variant ; p.Tyr66Phe; MODERATE | nonsynonymous_codon ; Y66F | Average:64.767; most accessible tissue: Zhenshan97 young leaf, score: 87.859 | benign |
0.129 |
TOLERATED | 0.12 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0612288311 | 7.32E-06 | NA | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612288311 | 3.40E-08 | 1.23E-07 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612288311 | 4.41E-06 | NA | mr1094 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612288311 | 9.09E-07 | NA | mr1096 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612288311 | 2.62E-07 | 3.53E-06 | mr1121 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612288311 | 1.51E-07 | 2.76E-07 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612288311 | 5.26E-06 | NA | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612288311 | 4.96E-08 | 2.63E-08 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612288311 | 4.58E-06 | NA | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612288311 | 3.99E-07 | 3.52E-07 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612288311 | 6.48E-06 | NA | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612288311 | 7.40E-08 | 5.66E-09 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |