Variant ID: vg0612270091 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 12270091 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 113. )
AATTACTCTTTTCTTGAATATCGGGATATTACTATTTTTTGTCCCCGTGTTCAAATGCTAAGTGCAGATGTCAACTTTGATATATATATCTGCTCGGTAT[T/C]
ATTTACACTTGTGTGTGACGTTCCTTGGGCAATAATATTATTGGTTTAATTTTCTTTATGTATTGCGTAAGAAGGTTTCGTATATAGACGCAGGGGTTCT
AGAACCCCTGCGTCTATATACGAAACCTTCTTACGCAATACATAAAGAAAATTAAACCAATAATATTATTGCCCAAGGAACGTCACACACAAGTGTAAAT[A/G]
ATACCGAGCAGATATATATATCAAAGTTGACATCTGCACTTAGCATTTGAACACGGGGACAAAAAATAGTAATATCCCGATATTCAAGAAAAGAGTAATT
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 50.60% | 49.40% | 0.06% | 0.00% | NA |
All Indica | 2759 | 23.80% | 76.10% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 98.30% | 1.70% | 0.07% | 0.00% | NA |
Aus | 269 | 36.40% | 63.60% | 0.00% | 0.00% | NA |
Indica I | 595 | 10.60% | 89.40% | 0.00% | 0.00% | NA |
Indica II | 465 | 16.30% | 83.70% | 0.00% | 0.00% | NA |
Indica III | 913 | 33.20% | 66.80% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 27.50% | 72.30% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 98.30% | 1.20% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 62.20% | 37.80% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0612270091 | T -> C | LOC_Os06g21230.1 | upstream_gene_variant ; 3387.0bp to feature; MODIFIER | silent_mutation | Average:34.264; most accessible tissue: Minghui63 root, score: 55.188 | N | N | N | N |
vg0612270091 | T -> C | LOC_Os06g21220-LOC_Os06g21230 | intergenic_region ; MODIFIER | silent_mutation | Average:34.264; most accessible tissue: Minghui63 root, score: 55.188 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0612270091 | NA | 3.53E-17 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612270091 | NA | 6.63E-19 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612270091 | NA | 9.58E-10 | mr1242 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612270091 | NA | 7.09E-20 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612270091 | NA | 4.46E-23 | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612270091 | NA | 1.49E-07 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612270091 | NA | 4.08E-22 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612270091 | NA | 1.21E-13 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |