\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612036184:

Variant ID: vg0612036184 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12036184
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.08, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GCACCCCTGTCGCCATCTCCTTGTCCACCAAATGCTTCAACGCCTAGAAGTTCACGTGCCCGAGCCGGGCATGCCAGAGCCACACCAGGTCGTCGAGAGT[C/T]
GAGACTGGCCAGCAAACACACAGGGGACGCCAACTTCAGCTCGATGCGATACAACCTGTTCACGGTTCTTCTCACCCTGATCACCAATCGACAGTGATTT

Reverse complement sequence

AAATCACTGTCGATTGGTGATCAGGGTGAGAAGAACCGTGAACAGGTTGTATCGCATCGAGCTGAAGTTGGCGTCCCCTGTGTGTTTGCTGGCCAGTCTC[G/A]
ACTCTCGACGACCTGGTGTGGCTCTGGCATGCCCGGCTCGGGCACGTGAACTTCTAGGCGTTGAAGCATTTGGTGGACAAGGAGATGGCGACAGGGGTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.60% 45.40% 0.11% 1.86% NA
All Indica  2759 29.70% 67.40% 0.18% 2.72% NA
All Japonica  1512 98.40% 1.30% 0.00% 0.26% NA
Aus  269 11.50% 88.10% 0.00% 0.37% NA
Indica I  595 4.20% 90.90% 0.34% 4.54% NA
Indica II  465 16.60% 81.90% 0.22% 1.29% NA
Indica III  913 54.00% 44.40% 0.11% 1.53% NA
Indica Intermediate  786 28.60% 67.70% 0.13% 3.56% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 1.70% 0.00% 1.66% NA
VI/Aromatic  96 92.70% 4.20% 0.00% 3.12% NA
Intermediate  90 65.60% 28.90% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612036184 C -> T LOC_Os06g20850.1 downstream_gene_variant ; 1532.0bp to feature; MODIFIER silent_mutation Average:51.257; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0612036184 C -> T LOC_Os06g20840.1 intron_variant ; MODIFIER silent_mutation Average:51.257; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0612036184 C -> DEL N N silent_mutation Average:51.257; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612036184 NA 7.89E-18 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612036184 NA 2.77E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612036184 NA 8.26E-22 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612036184 NA 1.51E-08 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612036184 NA 1.57E-30 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612036184 NA 2.38E-10 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612036184 NA 1.81E-09 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612036184 NA 5.54E-19 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612036184 NA 2.53E-10 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612036184 NA 2.38E-28 mr1242_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612036184 NA 2.59E-08 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612036184 NA 1.07E-22 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612036184 NA 6.09E-16 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612036184 NA 2.65E-07 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251