\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612029827:

Variant ID: vg0612029827 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12029827
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTTTACAAAGCAGTTGGTATATCACTCGGATCATGTTATTCGGAGACTCACACCGCATATGCTGTATATTGATATCAAGTCACTCGGTTGACTATAAT[T/G]
ATCAAAACCACTCAGTTGGTTGGATTATTTACTCCTTGACTATATGCTTAGTTTGTTCAACTAACCACATAGTCGGGGGCTACACCTATTAGGTGCATCT

Reverse complement sequence

AGATGCACCTAATAGGTGTAGCCCCCGACTATGTGGTTAGTTGAACAAACTAAGCATATAGTCAAGGAGTAAATAATCCAACCAACTGAGTGGTTTTGAT[A/C]
ATTATAGTCAACCGAGTGACTTGATATCAATATACAGCATATGCGGTGTGAGTCTCCGAATAACATGATCCGAGTGATATACCAACTGCTTTGTAAAATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.50% 7.30% 7.51% 38.68% NA
All Indica  2759 35.90% 1.10% 10.08% 52.95% NA
All Japonica  1512 69.60% 20.00% 2.18% 8.27% NA
Aus  269 21.20% 0.70% 9.29% 68.77% NA
Indica I  595 13.90% 0.00% 12.77% 73.28% NA
Indica II  465 21.90% 2.20% 13.76% 62.15% NA
Indica III  913 59.40% 0.30% 6.02% 34.28% NA
Indica Intermediate  786 33.60% 2.00% 10.56% 53.82% NA
Temperate Japonica  767 96.00% 1.30% 1.56% 1.17% NA
Tropical Japonica  504 30.60% 47.40% 2.38% 19.64% NA
Japonica Intermediate  241 67.20% 22.00% 3.73% 7.05% NA
VI/Aromatic  96 54.20% 5.20% 8.33% 32.29% NA
Intermediate  90 48.90% 10.00% 12.22% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612029827 T -> G LOC_Os06g20830.1 upstream_gene_variant ; 2524.0bp to feature; MODIFIER silent_mutation Average:13.234; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0612029827 T -> G LOC_Os06g20840.1 downstream_gene_variant ; 4665.0bp to feature; MODIFIER silent_mutation Average:13.234; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0612029827 T -> G LOC_Os06g20830-LOC_Os06g20840 intergenic_region ; MODIFIER silent_mutation Average:13.234; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0612029827 T -> DEL N N silent_mutation Average:13.234; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612029827 3.30E-07 3.02E-28 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612029827 6.18E-07 1.70E-22 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612029827 NA 7.93E-08 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612029827 NA 3.02E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612029827 NA 5.83E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612029827 NA 6.72E-20 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612029827 NA 1.48E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612029827 NA 2.92E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612029827 NA 4.46E-08 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612029827 1.36E-07 9.44E-31 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612029827 4.38E-06 3.89E-23 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612029827 NA 2.84E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612029827 NA 1.42E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612029827 1.09E-06 2.83E-18 mr1993_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251