\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611626674:

Variant ID: vg0611626674 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11626674
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGCTACATCTACCAACATGTAATATATTGTTAGTAACTGATAGATTTTATGACTGAAGATGTGCTCTAGGCTTAGTGTTGTGCATCCTGTTTCTTACC[T/A]
ACATATTTTGAGCCTAATTATATAATCATCGAAATATCATTATCACATGAAAATCTACCCCTTTTGTAGATCACCGCTGAATTGCTAAAGACCTGTTATA

Reverse complement sequence

TATAACAGGTCTTTAGCAATTCAGCGGTGATCTACAAAAGGGGTAGATTTTCATGTGATAATGATATTTCGATGATTATATAATTAGGCTCAAAATATGT[A/T]
GGTAAGAAACAGGATGCACAACACTAAGCCTAGAGCACATCTTCAGTCATAAAATCTATCAGTTACTAACAATATATTACATGTTGGTAGATGTAGCAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.20% 1.50% 1.29% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 91.50% 4.60% 3.84% 0.00% NA
Aus  269 98.90% 0.00% 1.12% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 89.20% 4.80% 6.00% 0.00% NA
Tropical Japonica  504 98.20% 1.20% 0.60% 0.00% NA
Japonica Intermediate  241 85.10% 11.20% 3.73% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611626674 T -> A LOC_Os06g20270.1 downstream_gene_variant ; 3387.0bp to feature; MODIFIER silent_mutation Average:34.984; most accessible tissue: Callus, score: 52.991 N N N N
vg0611626674 T -> A LOC_Os06g20260.1 intron_variant ; MODIFIER silent_mutation Average:34.984; most accessible tissue: Callus, score: 52.991 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611626674 NA 1.94E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611626674 NA 2.53E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611626674 NA 7.60E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611626674 NA 9.48E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611626674 NA 4.15E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611626674 NA 1.05E-06 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611626674 NA 7.12E-08 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611626674 6.00E-06 4.84E-08 mr1720 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611626674 NA 8.17E-07 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611626674 NA 4.95E-07 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611626674 NA 1.46E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611626674 NA 1.41E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251