Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611561231:

Variant ID: vg0611561231 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 11561231
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCCTAGTCTACACTATATTTATAGAGATAATCCATGAAATGCCATTGACAAGCGTTAAGTCCTAGAAATGCCATCGACAAGTGTGAGTTCCAAGAAATG[C/T]
CATCGTACAAGCGATTTTGTCCCAAAAATGCTATCGCCGTTAGGGTTCCGTCCATTCCGCGCCGTTAAATACACTGTTCATCCTATAGAACTTAACGGCG

Reverse complement sequence

CGCCGTTAAGTTCTATAGGATGAACAGTGTATTTAACGGCGCGGAATGGACGGAACCCTAACGGCGATAGCATTTTTGGGACAAAATCGCTTGTACGATG[G/A]
CATTTCTTGGAACTCACACTTGTCGATGGCATTTCTAGGACTTAACGCTTGTCAATGGCATTTCATGGATTATCTCTATAAATATAGTGTAGACTAGGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.20%	7.60%	0.15%	0.00%	NA
All Indica	2759	89.30%	10.40%	0.25%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	93.60%	5.90%	0.50%	0.00%	NA
Indica II	465	93.80%	6.00%	0.22%	0.00%	NA
Indica III	913	87.80%	12.20%	0.00%	0.00%	NA
Indica Intermediate	786	85.20%	14.40%	0.38%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	35.40%	64.60%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611561231	C -> T	LOC_Os06g20160.1	upstream_gene_variant ; 2358.0bp to feature; MODIFIER	silent_mutation	Average:40.969; most accessible tissue: Callus, score: 64.353	N	N	N	N
vg0611561231	C -> T	LOC_Os06g20140.1	downstream_gene_variant ; 4329.0bp to feature; MODIFIER	silent_mutation	Average:40.969; most accessible tissue: Callus, score: 64.353	N	N	N	N
vg0611561231	C -> T	LOC_Os06g20150.1	downstream_gene_variant ; 302.0bp to feature; MODIFIER	silent_mutation	Average:40.969; most accessible tissue: Callus, score: 64.353	N	N	N	N
vg0611561231	C -> T	LOC_Os06g20150-LOC_Os06g20160	intergenic_region ; MODIFIER	silent_mutation	Average:40.969; most accessible tissue: Callus, score: 64.353	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611561231	5.42E-06	NA	mr1091	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231	NA	7.83E-10	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231	NA	2.23E-06	mr1098	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231	NA	3.20E-09	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231	NA	5.06E-07	mr1150	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231	NA	8.07E-06	mr1225	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231	2.05E-07	NA	mr1234	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231	NA	1.96E-08	mr1234	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231	NA	2.06E-06	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231	NA	4.78E-07	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231	NA	1.16E-08	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231	9.00E-06	3.17E-09	mr1112_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231	4.31E-06	NA	mr1234_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251