\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611561231:

Variant ID: vg0611561231 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11561231
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCCTAGTCTACACTATATTTATAGAGATAATCCATGAAATGCCATTGACAAGCGTTAAGTCCTAGAAATGCCATCGACAAGTGTGAGTTCCAAGAAATG[C/T]
CATCGTACAAGCGATTTTGTCCCAAAAATGCTATCGCCGTTAGGGTTCCGTCCATTCCGCGCCGTTAAATACACTGTTCATCCTATAGAACTTAACGGCG

Reverse complement sequence

CGCCGTTAAGTTCTATAGGATGAACAGTGTATTTAACGGCGCGGAATGGACGGAACCCTAACGGCGATAGCATTTTTGGGACAAAATCGCTTGTACGATG[G/A]
CATTTCTTGGAACTCACACTTGTCGATGGCATTTCTAGGACTTAACGCTTGTCAATGGCATTTCATGGATTATCTCTATAAATATAGTGTAGACTAGGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.20% 7.60% 0.15% 0.00% NA
All Indica  2759 89.30% 10.40% 0.25% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 93.60% 5.90% 0.50% 0.00% NA
Indica II  465 93.80% 6.00% 0.22% 0.00% NA
Indica III  913 87.80% 12.20% 0.00% 0.00% NA
Indica Intermediate  786 85.20% 14.40% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 35.40% 64.60% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611561231 C -> T LOC_Os06g20160.1 upstream_gene_variant ; 2358.0bp to feature; MODIFIER silent_mutation Average:40.969; most accessible tissue: Callus, score: 64.353 N N N N
vg0611561231 C -> T LOC_Os06g20140.1 downstream_gene_variant ; 4329.0bp to feature; MODIFIER silent_mutation Average:40.969; most accessible tissue: Callus, score: 64.353 N N N N
vg0611561231 C -> T LOC_Os06g20150.1 downstream_gene_variant ; 302.0bp to feature; MODIFIER silent_mutation Average:40.969; most accessible tissue: Callus, score: 64.353 N N N N
vg0611561231 C -> T LOC_Os06g20150-LOC_Os06g20160 intergenic_region ; MODIFIER silent_mutation Average:40.969; most accessible tissue: Callus, score: 64.353 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611561231 5.42E-06 NA mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231 NA 7.83E-10 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231 NA 2.23E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231 NA 3.20E-09 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231 NA 5.06E-07 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231 NA 8.07E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231 2.05E-07 NA mr1234 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231 NA 1.96E-08 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231 NA 2.06E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231 NA 4.78E-07 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231 NA 1.16E-08 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231 9.00E-06 3.17E-09 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611561231 4.31E-06 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251