\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611539416:

Variant ID: vg0611539416 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11539416
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTATATTGTATACTAGAATAGGAAGAGAGTAGAGTAGAAGAAGTCAGAAGAATTCCAGTGTTGTCAGTAATCTTCTCCTATTTTTTTATTCTGTTTATTA[T/C]
TTTGAATTTAATATAATATTCTTCTTGAGTAATTTAGATTTATCTTGTGAGAATTATCTCCTAAATAGCATACGGGATTATTGTTCACTATAATCAACTA

Reverse complement sequence

TAGTTGATTATAGTGAACAATAATCCCGTATGCTATTTAGGAGATAATTCTCACAAGATAAATCTAAATTACTCAAGAAGAATATTATATTAAATTCAAA[A/G]
TAATAAACAGAATAAAAAAATAGGAGAAGATTACTGACAACACTGGAATTCTTCTGACTTCTTCTACTCTACTCTCTTCCTATTCTAGTATACAATATAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.80% 8.30% 3.60% 53.34% NA
All Indica  2759 5.00% 9.40% 4.71% 80.83% NA
All Japonica  1512 81.70% 7.90% 0.20% 10.12% NA
Aus  269 74.00% 0.00% 7.81% 18.22% NA
Indica I  595 9.20% 0.20% 1.51% 89.08% NA
Indica II  465 3.70% 0.60% 1.72% 93.98% NA
Indica III  913 1.40% 23.10% 8.43% 67.03% NA
Indica Intermediate  786 6.90% 5.70% 4.58% 82.82% NA
Temperate Japonica  767 82.90% 13.60% 0.13% 3.39% NA
Tropical Japonica  504 75.60% 0.60% 0.40% 23.41% NA
Japonica Intermediate  241 90.90% 5.40% 0.00% 3.73% NA
VI/Aromatic  96 32.30% 7.30% 9.38% 51.04% NA
Intermediate  90 43.30% 4.40% 7.78% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611539416 T -> C LOC_Os06g20120.1 downstream_gene_variant ; 1972.0bp to feature; MODIFIER silent_mutation Average:11.378; most accessible tissue: Callus, score: 27.183 N N N N
vg0611539416 T -> C LOC_Os06g20120-LOC_Os06g20130 intergenic_region ; MODIFIER silent_mutation Average:11.378; most accessible tissue: Callus, score: 27.183 N N N N
vg0611539416 T -> DEL N N silent_mutation Average:11.378; most accessible tissue: Callus, score: 27.183 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611539416 2.49E-06 NA Spikelet_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0611539416 NA 6.14E-07 Yield Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0611539416 NA 4.43E-09 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539416 NA 1.41E-07 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539416 NA 5.72E-08 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539416 NA 8.75E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251