\
| Variant ID: vg0611539103 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11539103 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 108. )
AACATCAGTGAATCAACCCAAAACTCCGAGAAATGGATAGAGGAAGGTCTAAGGAGTCCACCGACCGAAGGCCAGGCCAGGAGGGCCTAGCCCAGGTTTG[A/G]
CCGAACCCCCTGGTTCGGCCGAACCCCCCTGATCACCGTTGATCCTGGGGTTTGGCGTGGACACTCCAGATCACTCCCTGATGGCGCTTGCGGGGTACTT
AAGTACCCCGCAAGCGCCATCAGGGAGTGATCTGGAGTGTCCACGCCAAACCCCAGGATCAACGGTGATCAGGGGGGTTCGGCCGAACCAGGGGGTTCGG[T/C]
CAAACCTGGGCTAGGCCCTCCTGGCCTGGCCTTCGGTCGGTGGACTCCTTAGACCTTCCTCTATCCATTTCTCGGAGTTTTGGGTTGATTCACTGATGTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.00% | 1.20% | 8.61% | 46.23% | NA |
| All Indica | 2759 | 16.00% | 2.00% | 13.30% | 68.72% | NA |
| All Japonica | 1512 | 89.70% | 0.00% | 0.20% | 10.12% | NA |
| Aus | 269 | 75.50% | 0.00% | 11.90% | 12.64% | NA |
| Indica I | 595 | 10.60% | 0.00% | 5.55% | 83.87% | NA |
| Indica II | 465 | 5.80% | 0.20% | 8.17% | 85.81% | NA |
| Indica III | 913 | 25.10% | 4.60% | 19.50% | 50.82% | NA |
| Indica Intermediate | 786 | 15.50% | 1.50% | 15.01% | 67.94% | NA |
| Temperate Japonica | 767 | 96.50% | 0.00% | 0.13% | 3.39% | NA |
| Tropical Japonica | 504 | 76.20% | 0.00% | 0.20% | 23.61% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.00% | 0.41% | 3.32% | NA |
| VI/Aromatic | 96 | 36.50% | 0.00% | 2.08% | 61.46% | NA |
| Intermediate | 90 | 48.90% | 0.00% | 3.33% | 47.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611539103 | A -> G | LOC_Os06g20120.1 | downstream_gene_variant ; 1659.0bp to feature; MODIFIER | silent_mutation | Average:19.869; most accessible tissue: Zhenshan97 flag leaf, score: 26.688 | N | N | N | N |
| vg0611539103 | A -> G | LOC_Os06g20120-LOC_Os06g20130 | intergenic_region ; MODIFIER | silent_mutation | Average:19.869; most accessible tissue: Zhenshan97 flag leaf, score: 26.688 | N | N | N | N |
| vg0611539103 | A -> DEL | N | N | silent_mutation | Average:19.869; most accessible tissue: Zhenshan97 flag leaf, score: 26.688 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611539103 | NA | 2.84E-09 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611539103 | NA | 1.78E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611539103 | NA | 1.27E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611539103 | 6.96E-06 | 6.96E-06 | mr1413 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611539103 | NA | 3.68E-06 | mr1414 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611539103 | NA | 5.97E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611539103 | NA | 2.63E-08 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611539103 | NA | 3.05E-06 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611539103 | NA | 1.46E-08 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611539103 | NA | 3.10E-10 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611539103 | NA | 1.01E-06 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611539103 | NA | 8.44E-12 | mr1914 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611539103 | NA | 1.13E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611539103 | NA | 4.52E-10 | mr1927 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611539103 | NA | 3.17E-08 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |