\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611539103:

Variant ID: vg0611539103 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11539103
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


AACATCAGTGAATCAACCCAAAACTCCGAGAAATGGATAGAGGAAGGTCTAAGGAGTCCACCGACCGAAGGCCAGGCCAGGAGGGCCTAGCCCAGGTTTG[A/G]
CCGAACCCCCTGGTTCGGCCGAACCCCCCTGATCACCGTTGATCCTGGGGTTTGGCGTGGACACTCCAGATCACTCCCTGATGGCGCTTGCGGGGTACTT

Reverse complement sequence

AAGTACCCCGCAAGCGCCATCAGGGAGTGATCTGGAGTGTCCACGCCAAACCCCAGGATCAACGGTGATCAGGGGGGTTCGGCCGAACCAGGGGGTTCGG[T/C]
CAAACCTGGGCTAGGCCCTCCTGGCCTGGCCTTCGGTCGGTGGACTCCTTAGACCTTCCTCTATCCATTTCTCGGAGTTTTGGGTTGATTCACTGATGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.00% 1.20% 8.61% 46.23% NA
All Indica  2759 16.00% 2.00% 13.30% 68.72% NA
All Japonica  1512 89.70% 0.00% 0.20% 10.12% NA
Aus  269 75.50% 0.00% 11.90% 12.64% NA
Indica I  595 10.60% 0.00% 5.55% 83.87% NA
Indica II  465 5.80% 0.20% 8.17% 85.81% NA
Indica III  913 25.10% 4.60% 19.50% 50.82% NA
Indica Intermediate  786 15.50% 1.50% 15.01% 67.94% NA
Temperate Japonica  767 96.50% 0.00% 0.13% 3.39% NA
Tropical Japonica  504 76.20% 0.00% 0.20% 23.61% NA
Japonica Intermediate  241 96.30% 0.00% 0.41% 3.32% NA
VI/Aromatic  96 36.50% 0.00% 2.08% 61.46% NA
Intermediate  90 48.90% 0.00% 3.33% 47.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611539103 A -> G LOC_Os06g20120.1 downstream_gene_variant ; 1659.0bp to feature; MODIFIER silent_mutation Average:19.869; most accessible tissue: Zhenshan97 flag leaf, score: 26.688 N N N N
vg0611539103 A -> G LOC_Os06g20120-LOC_Os06g20130 intergenic_region ; MODIFIER silent_mutation Average:19.869; most accessible tissue: Zhenshan97 flag leaf, score: 26.688 N N N N
vg0611539103 A -> DEL N N silent_mutation Average:19.869; most accessible tissue: Zhenshan97 flag leaf, score: 26.688 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611539103 NA 2.84E-09 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539103 NA 1.78E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539103 NA 1.27E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539103 6.96E-06 6.96E-06 mr1413 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539103 NA 3.68E-06 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539103 NA 5.97E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539103 NA 2.63E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539103 NA 3.05E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539103 NA 1.46E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539103 NA 3.10E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539103 NA 1.01E-06 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539103 NA 8.44E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539103 NA 1.13E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539103 NA 4.52E-10 mr1927 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611539103 NA 3.17E-08 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251