\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611336250:

Variant ID: vg0611336250 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11336250
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.17, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTTACAATTGAACCGGCCATGTCCCTTATATAGGGGTTGGTCTTGCCCTCTACAGGCCCTCCTCCACGTCTAACTCGGGATAGAATCCAAAGGAAACC[T/C]
GAAACATGCCTTCTCGAGCAAGGAAACCTCGAGACCCGGCGAAACAGACCAGGACTCGGACTCTGCCGGTCAGACTGGCCACATACCGCGGGTTTGACCG

Reverse complement sequence

CGGTCAAACCCGCGGTATGTGGCCAGTCTGACCGGCAGAGTCCGAGTCCTGGTCTGTTTCGCCGGGTCTCGAGGTTTCCTTGCTCGAGAAGGCATGTTTC[A/G]
GGTTTCCTTTGGATTCTATCCCGAGTTAGACGTGGAGGAGGGCCTGTAGAGGGCAAGACCAACCCCTATATAAGGGACATGGCCGGTTCAATTGTAACTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.10% 40.80% 4.89% 1.25% NA
All Indica  2759 82.50% 9.50% 8.01% 0.00% NA
All Japonica  1512 7.50% 88.60% 0.20% 3.70% NA
Aus  269 25.70% 74.30% 0.00% 0.00% NA
Indica I  595 91.60% 7.10% 1.34% 0.00% NA
Indica II  465 94.80% 3.20% 1.94% 0.00% NA
Indica III  913 67.50% 14.50% 18.07% 0.00% NA
Indica Intermediate  786 85.90% 9.20% 4.96% 0.00% NA
Temperate Japonica  767 4.20% 95.80% 0.00% 0.00% NA
Tropical Japonica  504 13.30% 75.40% 0.40% 10.91% NA
Japonica Intermediate  241 5.80% 93.40% 0.41% 0.41% NA
VI/Aromatic  96 10.40% 84.40% 5.21% 0.00% NA
Intermediate  90 45.60% 48.90% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611336250 T -> C LOC_Os06g19840.1 upstream_gene_variant ; 3574.0bp to feature; MODIFIER silent_mutation Average:61.445; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N
vg0611336250 T -> C LOC_Os06g19854.1 downstream_gene_variant ; 592.0bp to feature; MODIFIER silent_mutation Average:61.445; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N
vg0611336250 T -> C LOC_Os06g19840-LOC_Os06g19854 intergenic_region ; MODIFIER silent_mutation Average:61.445; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N
vg0611336250 T -> DEL N N silent_mutation Average:61.445; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0611336250 T C -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611336250 NA 2.34E-08 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 2.65E-22 mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 1.37E-07 2.43E-10 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 6.54E-30 mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 3.63E-06 3.33E-09 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 2.62E-55 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 5.32E-07 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 2.18E-53 mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 6.09E-06 9.50E-12 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 3.02E-08 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 8.14E-09 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 8.88E-07 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 1.79E-07 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 4.65E-49 mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 9.06E-11 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 2.27E-12 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 5.30E-30 mr1237 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 2.11E-06 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 1.91E-06 mr1264 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 1.42E-06 1.26E-11 mr1411 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 7.41E-07 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 3.51E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 5.75E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 6.87E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 9.64E-06 mr1878 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 3.98E-06 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 8.13E-09 3.69E-10 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 NA 3.80E-54 mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 2.06E-06 2.06E-06 mr1477_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611336250 3.60E-07 3.60E-07 mr1971_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251