\
| Variant ID: vg0611330297 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 11330297 |
| Reference Allele: A | Alternative Allele: T,AT |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATGATATGCTATATGTATGCTAAGCTCTTATACATTAGTGAACATAATTCCTATGCTTGATGAAATCATTGTCAAAAGGGGGAGAAGGAATATAAAAAAA[A/T,AT]
TTGGACTTTTGGGAGCTGAGAAGAGTTTTTGAGAAGAGCAATGTTTTTGGTTCAATTGAGAATTTCTTTATTTTAAAAAGGGGGAGAAGTTTTCTTTTGG
CCAAAAGAAAACTTCTCCCCCTTTTTAAAATAAAGAAATTCTCAATTGAACCAAAAACATTGCTCTTCTCAAAAACTCTTCTCAGCTCCCAAAAGTCCAA[T/A,AT]
TTTTTTTATATTCCTTCTCCCCCTTTTGACAATGATTTCATCAAGCATAGGAATTATGTTCACTAATGTATAAGAGCTTAGCATACATATAGCATATCAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.20% | 38.20% | 0.59% | 8.95% | AT: 0.08% |
| All Indica | 2759 | 81.00% | 5.30% | 0.58% | 13.01% | AT: 0.11% |
| All Japonica | 1512 | 7.30% | 88.40% | 0.73% | 3.51% | AT: 0.07% |
| Aus | 269 | 26.00% | 74.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.80% | 6.60% | 0.50% | 1.01% | AT: 0.17% |
| Indica II | 465 | 94.60% | 2.80% | 0.00% | 2.58% | NA |
| Indica III | 913 | 63.10% | 5.30% | 0.99% | 30.67% | NA |
| Indica Intermediate | 786 | 85.50% | 6.00% | 0.51% | 7.76% | AT: 0.25% |
| Temperate Japonica | 767 | 3.80% | 95.70% | 0.39% | 0.00% | AT: 0.13% |
| Tropical Japonica | 504 | 13.30% | 75.20% | 1.59% | 9.92% | NA |
| Japonica Intermediate | 241 | 5.80% | 92.90% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 10.40% | 82.30% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 46.70% | 47.80% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611330297 | A -> T | LOC_Os06g19830.1 | downstream_gene_variant ; 2438.0bp to feature; MODIFIER | silent_mutation | Average:20.788; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0611330297 | A -> T | LOC_Os06g19840.1 | downstream_gene_variant ; 1441.0bp to feature; MODIFIER | silent_mutation | Average:20.788; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0611330297 | A -> T | LOC_Os06g19830-LOC_Os06g19840 | intergenic_region ; MODIFIER | silent_mutation | Average:20.788; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0611330297 | A -> DEL | N | N | silent_mutation | Average:20.788; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0611330297 | A -> AT | LOC_Os06g19830.1 | downstream_gene_variant ; 2439.0bp to feature; MODIFIER | silent_mutation | Average:20.788; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0611330297 | A -> AT | LOC_Os06g19840.1 | downstream_gene_variant ; 1440.0bp to feature; MODIFIER | silent_mutation | Average:20.788; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0611330297 | A -> AT | LOC_Os06g19830-LOC_Os06g19840 | intergenic_region ; MODIFIER | silent_mutation | Average:20.788; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611330297 | NA | 3.24E-09 | mr1033 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 3.61E-07 | 1.49E-60 | mr1065 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 3.61E-08 | 1.10E-11 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 1.43E-42 | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 3.87E-55 | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 1.63E-06 | 9.82E-09 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 1.95E-50 | mr1078 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 7.93E-08 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 3.48E-06 | 1.51E-59 | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 6.52E-08 | 1.57E-10 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 2.57E-06 | 2.47E-54 | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 9.23E-07 | NA | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 6.62E-40 | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 1.12E-07 | 5.01E-10 | mr1091 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 2.27E-35 | mr1094 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 2.03E-06 | 1.48E-07 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 4.00E-45 | mr1108 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 3.82E-47 | mr1111 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 2.10E-07 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 7.71E-06 | 1.54E-46 | mr1112 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 2.44E-06 | 8.44E-09 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 1.20E-06 | 1.65E-50 | mr1121 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 8.82E-08 | 1.09E-08 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 7.47E-06 | 3.01E-47 | mr1144 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 1.87E-08 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 2.62E-06 | mr1176 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 3.26E-45 | mr1200 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 2.41E-07 | mr1200 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 2.88E-49 | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 1.86E-31 | mr1237 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 1.16E-07 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 2.14E-45 | mr1526 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 1.81E-08 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 1.25E-65 | mr1065_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 1.40E-07 | 1.25E-12 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 2.65E-57 | mr1067_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 6.42E-06 | 8.83E-69 | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 1.13E-06 | 4.43E-11 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 1.63E-62 | mr1078_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 8.17E-06 | 6.23E-09 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 5.23E-70 | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 4.41E-07 | 3.31E-11 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 3.20E-62 | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 3.59E-06 | NA | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 4.51E-49 | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 6.08E-06 | NA | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 9.68E-59 | mr1096_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 2.92E-06 | 1.06E-08 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 5.87E-57 | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 1.90E-07 | 6.13E-12 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 2.10E-06 | 2.10E-55 | mr1111_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 1.20E-08 | 1.97E-11 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 5.18E-61 | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 1.64E-06 | 5.14E-11 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 1.14E-06 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 4.51E-06 | 4.19E-55 | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 8.48E-07 | 1.02E-09 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 5.08E-07 | NA | mr1165_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 4.29E-06 | 1.97E-58 | mr1200_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 3.72E-07 | 4.57E-10 | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 1.74E-57 | mr1211_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | 6.40E-06 | 2.89E-06 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 3.60E-57 | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 1.77E-10 | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 7.05E-08 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611330297 | NA | 5.20E-22 | mr1877_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |