\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611255073:

Variant ID: vg0611255073 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 11255073
Reference Allele: CAlternative Allele: T,CTTTTT,CTTTTTGTTTT
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GATTTGTTTTGTTTTGGAAACATTCCGAAAAATCCGGTGCGTGAAAACGGCATGGAGCCAGGATAGGTTACGCGCGACTTATCCGGTTCGGTTTACGCGG[C/T,CTTTTT,CTTTTTGTTTT]
GCCCTGATCAGGCGATCTATCTCTATATAAACCGAGCCGCCGCCTTCACGCAACACACGCGAAATCAATCTAGGGTTTGCCTCCTACTCTGTAATGCGCC

Reverse complement sequence

GGCGCATTACAGAGTAGGAGGCAAACCCTAGATTGATTTCGCGTGTGTTGCGTGAAGGCGGCGGCTCGGTTTATATAGAGATAGATCGCCTGATCAGGGC[G/A,AAAAAG,AAAACAAAAAG]
CCGCGTAAACCGAACCGGATAAGTCGCGCGTAACCTATCCTGGCTCCATGCCGTTTTCACGCACCGGATTTTTCGGAATGTTTCCAAAACAAAACAAATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.80% 37.90% 0.21% 0.00% NA
All Indica  2759 95.00% 4.70% 0.25% 0.00% NA
All Japonica  1512 11.40% 88.50% 0.07% 0.00% NA
Aus  269 26.00% 74.00% 0.00% 0.00% NA
Indica I  595 98.20% 1.30% 0.50% 0.00% NA
Indica II  465 94.20% 5.80% 0.00% 0.00% NA
Indica III  913 94.30% 5.60% 0.11% 0.00% NA
Indica Intermediate  786 93.90% 5.70% 0.38% 0.00% NA
Temperate Japonica  767 4.20% 95.80% 0.00% 0.00% NA
Tropical Japonica  504 24.80% 75.00% 0.20% 0.00% NA
Japonica Intermediate  241 6.60% 93.40% 0.00% 0.00% NA
VI/Aromatic  96 14.60% 85.40% 0.00% 0.00% NA
Intermediate  90 50.00% 47.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611255073 C -> CTTTTT LOC_Os06g19710.1 upstream_gene_variant ; 604.0bp to feature; MODIFIER N Average:23.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N
vg0611255073 C -> CTTTTT LOC_Os06g19700.1 downstream_gene_variant ; 913.0bp to feature; MODIFIER N Average:23.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N
vg0611255073 C -> CTTTTT LOC_Os06g19700-LOC_Os06g19710 intergenic_region ; MODIFIER N Average:23.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N
vg0611255073 C -> T LOC_Os06g19710.1 upstream_gene_variant ; 605.0bp to feature; MODIFIER silent_mutation Average:23.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N
vg0611255073 C -> T LOC_Os06g19700.1 downstream_gene_variant ; 912.0bp to feature; MODIFIER silent_mutation Average:23.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N
vg0611255073 C -> T LOC_Os06g19700-LOC_Os06g19710 intergenic_region ; MODIFIER silent_mutation Average:23.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N
vg0611255073 C -> CTTTTTGTTTT LOC_Os06g19710.1 upstream_gene_variant ; 604.0bp to feature; MODIFIER N Average:23.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N
vg0611255073 C -> CTTTTTGTTTT LOC_Os06g19700.1 downstream_gene_variant ; 913.0bp to feature; MODIFIER N Average:23.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N
vg0611255073 C -> CTTTTTGTTTT LOC_Os06g19700-LOC_Os06g19710 intergenic_region ; MODIFIER N Average:23.398; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611255073 1.51E-06 NA mr1065 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 7.17E-07 NA mr1065 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 1.74E-06 NA mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 8.41E-08 8.59E-58 mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 1.81E-06 NA mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 1.14E-06 NA mr1091 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 1.04E-06 NA mr1096 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 1.67E-06 1.67E-06 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 NA 8.54E-50 mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 2.81E-08 2.81E-08 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 1.15E-06 NA mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 2.24E-06 NA mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 8.93E-06 NA mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 NA 1.86E-63 mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 1.19E-06 NA mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 1.25E-06 NA mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 3.22E-06 1.81E-63 mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 2.61E-06 NA mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 7.39E-06 NA mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 9.02E-07 NA mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 4.38E-06 5.07E-52 mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 5.64E-08 NA mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 2.47E-06 2.12E-52 mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 4.08E-08 NA mr1144_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 NA 1.45E-12 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 4.84E-13 4.84E-14 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 NA 1.27E-53 mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 NA 1.32E-57 mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 2.37E-06 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 4.11E-08 4.11E-08 mr1477_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 NA 3.58E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611255073 4.78E-09 4.79E-09 mr1971_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251