\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611109671:

Variant ID: vg0611109671 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11109671
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


ACTACTGTAAGATTGTTAGAAATTCTTTGTATTGCTTGTGACTGTAATCGAGAGGGTCCAAGACTACCACGATTCCGTCTTTAGGGTGGATGAGTAAACA[G/T]
ATATAATGATCGCTACATATTAACAACAGTATAGTTAGTTAGTACCAGCTAAAATAAGACATATGTGTACAAGATAAATGTACCAGACTTACTTAAAATT

Reverse complement sequence

AATTTTAAGTAAGTCTGGTACATTTATCTTGTACACATATGTCTTATTTTAGCTGGTACTAACTAACTATACTGTTGTTAATATGTAGCGATCATTATAT[C/A]
TGTTTACTCATCCACCCTAAAGACGGAATCGTGGTAGTCTTGGACCCTCTCGATTACAGTCACAAGCAATACAAAGAATTTCTAACAATCTTACAGTAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.90% 8.40% 9.20% 1.50% NA
All Indica  2759 68.90% 13.20% 15.33% 2.57% NA
All Japonica  1512 98.30% 1.30% 0.40% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 33.80% 23.90% 36.30% 6.05% NA
Indica II  465 93.50% 3.20% 3.01% 0.22% NA
Indica III  913 79.40% 12.20% 6.68% 1.75% NA
Indica Intermediate  786 68.60% 12.30% 16.79% 2.29% NA
Temperate Japonica  767 98.20% 1.60% 0.26% 0.00% NA
Tropical Japonica  504 99.40% 0.20% 0.40% 0.00% NA
Japonica Intermediate  241 96.70% 2.50% 0.83% 0.00% NA
VI/Aromatic  96 92.70% 4.20% 3.12% 0.00% NA
Intermediate  90 88.90% 7.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611109671 G -> T LOC_Os06g19500.1 upstream_gene_variant ; 4482.0bp to feature; MODIFIER silent_mutation Average:22.981; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0611109671 G -> T LOC_Os06g19520.1 downstream_gene_variant ; 2348.0bp to feature; MODIFIER silent_mutation Average:22.981; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0611109671 G -> T LOC_Os06g19510.1 intron_variant ; MODIFIER silent_mutation Average:22.981; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0611109671 G -> DEL N N silent_mutation Average:22.981; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611109671 NA 8.08E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611109671 1.48E-06 NA mr1255_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611109671 2.28E-06 NA mr1255_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251