| Variant ID: vg0611109671 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11109671 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )
ACTACTGTAAGATTGTTAGAAATTCTTTGTATTGCTTGTGACTGTAATCGAGAGGGTCCAAGACTACCACGATTCCGTCTTTAGGGTGGATGAGTAAACA[G/T]
ATATAATGATCGCTACATATTAACAACAGTATAGTTAGTTAGTACCAGCTAAAATAAGACATATGTGTACAAGATAAATGTACCAGACTTACTTAAAATT
AATTTTAAGTAAGTCTGGTACATTTATCTTGTACACATATGTCTTATTTTAGCTGGTACTAACTAACTATACTGTTGTTAATATGTAGCGATCATTATAT[C/A]
TGTTTACTCATCCACCCTAAAGACGGAATCGTGGTAGTCTTGGACCCTCTCGATTACAGTCACAAGCAATACAAAGAATTTCTAACAATCTTACAGTAGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.90% | 8.40% | 9.20% | 1.50% | NA |
| All Indica | 2759 | 68.90% | 13.20% | 15.33% | 2.57% | NA |
| All Japonica | 1512 | 98.30% | 1.30% | 0.40% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 33.80% | 23.90% | 36.30% | 6.05% | NA |
| Indica II | 465 | 93.50% | 3.20% | 3.01% | 0.22% | NA |
| Indica III | 913 | 79.40% | 12.20% | 6.68% | 1.75% | NA |
| Indica Intermediate | 786 | 68.60% | 12.30% | 16.79% | 2.29% | NA |
| Temperate Japonica | 767 | 98.20% | 1.60% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 4.20% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 7.80% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611109671 | G -> T | LOC_Os06g19500.1 | upstream_gene_variant ; 4482.0bp to feature; MODIFIER | silent_mutation | Average:22.981; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0611109671 | G -> T | LOC_Os06g19520.1 | downstream_gene_variant ; 2348.0bp to feature; MODIFIER | silent_mutation | Average:22.981; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0611109671 | G -> T | LOC_Os06g19510.1 | intron_variant ; MODIFIER | silent_mutation | Average:22.981; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0611109671 | G -> DEL | N | N | silent_mutation | Average:22.981; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611109671 | NA | 8.08E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611109671 | 1.48E-06 | NA | mr1255_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611109671 | 2.28E-06 | NA | mr1255_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |