\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611042230:

Variant ID: vg0611042230 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11042230
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, C: 0.35, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGACATAATCTAGAATAAATGCTTTACGTTTTGCATTTGATACTAAAGAATCTCCTACTGTGGGCACCAAAAGCATATCTATTTTACCTATATCCCCT[A/C]
TTCATACATGCTGCTTTTTTCTTGCTCCAAAAATCTATACCTTTTCAACCCTATTTATGGGTGTAACTCCAATCATTTTTGTACTCCAAAAAAAAAAGTT

Reverse complement sequence

AACTTTTTTTTTTGGAGTACAAAAATGATTGGAGTTACACCCATAAATAGGGTTGAAAAGGTATAGATTTTTGGAGCAAGAAAAAAGCAGCATGTATGAA[T/G]
AGGGGATATAGGTAAAATAGATATGCTTTTGGTGCCCACAGTAGGAGATTCTTTAGTATCAAATGCAAAACGTAAAGCATTTATTCTAGATTATGTCTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 33.70% 0.06% 0.00% NA
All Indica  2759 44.30% 55.60% 0.04% 0.00% NA
All Japonica  1512 97.70% 2.20% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 20.70% 79.20% 0.17% 0.00% NA
Indica II  465 88.60% 11.40% 0.00% 0.00% NA
Indica III  913 34.00% 66.00% 0.00% 0.00% NA
Indica Intermediate  786 48.10% 51.90% 0.00% 0.00% NA
Temperate Japonica  767 97.30% 2.50% 0.26% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611042230 A -> C LOC_Os06g19400.1 upstream_gene_variant ; 4150.0bp to feature; MODIFIER silent_mutation Average:60.211; most accessible tissue: Callus, score: 83.357 N N N N
vg0611042230 A -> C LOC_Os06g19390.1 intron_variant ; MODIFIER silent_mutation Average:60.211; most accessible tissue: Callus, score: 83.357 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611042230 NA 1.98E-07 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611042230 NA 1.16E-12 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611042230 NA 1.08E-06 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611042230 6.22E-06 NA mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611042230 NA 1.70E-08 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611042230 NA 4.90E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611042230 1.60E-07 5.82E-09 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611042230 NA 1.04E-12 mr1860_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611042230 NA 4.44E-06 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611042230 NA 1.49E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611042230 NA 9.04E-07 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251