Variant ID: vg0611042230 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 11042230 |
Reference Allele: A | Alternative Allele: C |
Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, C: 0.35, others allele: 0.00, population size: 204. )
GAAGACATAATCTAGAATAAATGCTTTACGTTTTGCATTTGATACTAAAGAATCTCCTACTGTGGGCACCAAAAGCATATCTATTTTACCTATATCCCCT[A/C]
TTCATACATGCTGCTTTTTTCTTGCTCCAAAAATCTATACCTTTTCAACCCTATTTATGGGTGTAACTCCAATCATTTTTGTACTCCAAAAAAAAAAGTT
AACTTTTTTTTTTGGAGTACAAAAATGATTGGAGTTACACCCATAAATAGGGTTGAAAAGGTATAGATTTTTGGAGCAAGAAAAAAGCAGCATGTATGAA[T/G]
AGGGGATATAGGTAAAATAGATATGCTTTTGGTGCCCACAGTAGGAGATTCTTTAGTATCAAATGCAAAACGTAAAGCATTTATTCTAGATTATGTCTTC
Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 66.30% | 33.70% | 0.06% | 0.00% | NA |
All Indica | 2759 | 44.30% | 55.60% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 97.70% | 2.20% | 0.13% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 20.70% | 79.20% | 0.17% | 0.00% | NA |
Indica II | 465 | 88.60% | 11.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 34.00% | 66.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 48.10% | 51.90% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 97.30% | 2.50% | 0.26% | 0.00% | NA |
Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0611042230 | A -> C | LOC_Os06g19400.1 | upstream_gene_variant ; 4150.0bp to feature; MODIFIER | silent_mutation | Average:60.211; most accessible tissue: Callus, score: 83.357 | N | N | N | N |
vg0611042230 | A -> C | LOC_Os06g19390.1 | intron_variant ; MODIFIER | silent_mutation | Average:60.211; most accessible tissue: Callus, score: 83.357 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0611042230 | NA | 1.98E-07 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611042230 | NA | 1.16E-12 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611042230 | NA | 1.08E-06 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611042230 | 6.22E-06 | NA | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611042230 | NA | 1.70E-08 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611042230 | NA | 4.90E-06 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611042230 | 1.60E-07 | 5.82E-09 | mr1165_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611042230 | NA | 1.04E-12 | mr1860_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611042230 | NA | 4.44E-06 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611042230 | NA | 1.49E-06 | mr1928_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611042230 | NA | 9.04E-07 | mr1931_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |