Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610849825:

Variant ID: vg0610849825 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10849825
Reference Allele: G	Alternative Allele: A,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTTCATGGGGAAGTCGGTGGTCATAACGAAGAGTTAGATTATTTCTGTTTTGATGATGCAGAAAATTTTATAATCGAAGACATGTCATAGGGAAACAT[G/A,C]
CCGGAATATGGTGGCTCTAGTATAGAGAATGAATGTATTGATTTTGATCTGGAAGATATGTTACGGCACGTTGAACCAGTGGTCATAACTAGTAGAAGAC

Reverse complement sequence

GTCTTCTACTAGTTATGACCACTGGTTCAACGTGCCGTAACATATCTTCCAGATCAAAATCAATACATTCATTCTCTATACTAGAGCCACCATATTCCGG[C/T,G]
ATGTTTCCCTATGACATGTCTTCGATTATAAAATTTTCTGCATCATCAAAACAGAAATAATCTAACTCTTCGTTATGACCACCGACTTCCCCATGAAAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.00%	2.20%	41.90%	4.74%	C: 2.16%
All Indica	2759	21.10%	3.30%	64.70%	7.83%	C: 3.04%
All Japonica	1512	92.00%	0.20%	6.61%	0.40%	C: 0.79%
Aus	269	82.90%	0.40%	15.99%	0.00%	C: 0.74%
Indica I	595	14.10%	2.40%	65.21%	16.13%	C: 2.18%
Indica II	465	8.80%	4.50%	73.98%	9.46%	C: 3.23%
Indica III	913	27.70%	2.70%	62.87%	2.19%	C: 4.49%
Indica Intermediate	786	26.00%	4.10%	60.94%	7.12%	C: 1.91%
Temperate Japonica	767	96.30%	0.00%	3.00%	0.39%	C: 0.26%
Tropical Japonica	504	85.10%	0.60%	12.90%	0.00%	C: 1.39%
Japonica Intermediate	241	92.50%	0.00%	4.98%	1.24%	C: 1.24%
VI/Aromatic	96	80.20%	2.10%	15.62%	1.04%	C: 1.04%
Intermediate	90	50.00%	4.40%	41.11%	1.11%	C: 3.33%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610849825	G -> C	LOC_Os06g19080.1	start_lost ; p.Met1?; HIGH	nonsynonymous_codon ; M1I	Average:11.256; most accessible tissue: Callus, score: 49.672	unknown	unknown	TOLERATED	1.00
vg0610849825	G -> A	LOC_Os06g19080.1	start_lost ; p.Met1?; HIGH	nonsynonymous_codon ; M1I	Average:11.256; most accessible tissue: Callus, score: 49.672	unknown	unknown	TOLERATED	1.00
vg0610849825	G -> DEL	LOC_Os06g19080.1	N	frameshift_variant	Average:11.256; most accessible tissue: Callus, score: 49.672	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610849825	NA	4.17E-16	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825	9.55E-07	8.05E-54	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825	NA	7.83E-19	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825	2.70E-06	2.70E-06	mr1165	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825	NA	3.02E-16	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825	3.14E-08	3.14E-08	mr1478	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825	NA	1.44E-06	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825	3.50E-07	NA	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825	1.98E-06	9.90E-61	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825	7.90E-10	5.77E-26	mr1165_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825	1.60E-11	2.31E-14	mr1165_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825	1.74E-06	NA	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825	1.58E-06	1.58E-06	mr1477_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825	1.00E-06	2.44E-12	mr1478_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825	3.46E-07	3.46E-07	mr1478_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825	3.88E-08	3.22E-27	mr1971_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825	1.17E-11	1.17E-11	mr1971_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251