\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610849825:

Variant ID: vg0610849825 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10849825
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTTCATGGGGAAGTCGGTGGTCATAACGAAGAGTTAGATTATTTCTGTTTTGATGATGCAGAAAATTTTATAATCGAAGACATGTCATAGGGAAACAT[G/A,C]
CCGGAATATGGTGGCTCTAGTATAGAGAATGAATGTATTGATTTTGATCTGGAAGATATGTTACGGCACGTTGAACCAGTGGTCATAACTAGTAGAAGAC

Reverse complement sequence

GTCTTCTACTAGTTATGACCACTGGTTCAACGTGCCGTAACATATCTTCCAGATCAAAATCAATACATTCATTCTCTATACTAGAGCCACCATATTCCGG[C/T,G]
ATGTTTCCCTATGACATGTCTTCGATTATAAAATTTTCTGCATCATCAAAACAGAAATAATCTAACTCTTCGTTATGACCACCGACTTCCCCATGAAAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.00% 2.20% 41.90% 4.74% C: 2.16%
All Indica  2759 21.10% 3.30% 64.70% 7.83% C: 3.04%
All Japonica  1512 92.00% 0.20% 6.61% 0.40% C: 0.79%
Aus  269 82.90% 0.40% 15.99% 0.00% C: 0.74%
Indica I  595 14.10% 2.40% 65.21% 16.13% C: 2.18%
Indica II  465 8.80% 4.50% 73.98% 9.46% C: 3.23%
Indica III  913 27.70% 2.70% 62.87% 2.19% C: 4.49%
Indica Intermediate  786 26.00% 4.10% 60.94% 7.12% C: 1.91%
Temperate Japonica  767 96.30% 0.00% 3.00% 0.39% C: 0.26%
Tropical Japonica  504 85.10% 0.60% 12.90% 0.00% C: 1.39%
Japonica Intermediate  241 92.50% 0.00% 4.98% 1.24% C: 1.24%
VI/Aromatic  96 80.20% 2.10% 15.62% 1.04% C: 1.04%
Intermediate  90 50.00% 4.40% 41.11% 1.11% C: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610849825 G -> C LOC_Os06g19080.1 start_lost ; p.Met1?; HIGH nonsynonymous_codon ; M1I Average:11.256; most accessible tissue: Callus, score: 49.672 unknown unknown TOLERATED 1.00
vg0610849825 G -> A LOC_Os06g19080.1 start_lost ; p.Met1?; HIGH nonsynonymous_codon ; M1I Average:11.256; most accessible tissue: Callus, score: 49.672 unknown unknown TOLERATED 1.00
vg0610849825 G -> DEL LOC_Os06g19080.1 N frameshift_variant Average:11.256; most accessible tissue: Callus, score: 49.672 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610849825 NA 4.17E-16 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825 9.55E-07 8.05E-54 mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825 NA 7.83E-19 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825 2.70E-06 2.70E-06 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825 NA 3.02E-16 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825 3.14E-08 3.14E-08 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825 NA 1.44E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825 3.50E-07 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825 1.98E-06 9.90E-61 mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825 7.90E-10 5.77E-26 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825 1.60E-11 2.31E-14 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825 1.74E-06 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825 1.58E-06 1.58E-06 mr1477_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825 1.00E-06 2.44E-12 mr1478_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825 3.46E-07 3.46E-07 mr1478_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825 3.88E-08 3.22E-27 mr1971_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849825 1.17E-11 1.17E-11 mr1971_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251