Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610802461:

Variant ID: vg0610802461 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10802461
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCTCTTTTGTCACTAAAATACTAACCGCCGTCACAGCCACTGTGCTTGTTGTCAGCGTTCTTCGCGCCACCCTTGTTGTCTTCGTGCGGCTTAGGCGCC[A/G]
CCTTCGCGTCGCTGGCATTAGTGCCTCTCTCTTGGCGGCGCGCGGCGAGGCATGCGGCGAGGTGGGTTCTTGTGGTGGCGCTTTGACCCGCCGCTGCCGC

Reverse complement sequence

GCGGCAGCGGCGGGTCAAAGCGCCACCACAAGAACCCACCTCGCCGCATGCCTCGCCGCGCGCCGCCAAGAGAGAGGCACTAATGCCAGCGACGCGAAGG[T/C]
GGCGCCTAAGCCGCACGAAGACAACAAGGGTGGCGCGAAGAACGCTGACAACAAGCACAGTGGCTGTGACGGCGGTTAGTATTTTAGTGACAAAAGAGAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.20%	5.80%	0.00%	0.00%	NA
All Indica	2759	90.20%	9.80%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	82.40%	17.60%	0.00%	0.00%	NA
Indica Intermediate	786	86.50%	13.50%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610802461	A -> G	LOC_Os06g18970.1	upstream_gene_variant ; 3812.0bp to feature; MODIFIER	silent_mutation	Average:73.599; most accessible tissue: Zhenshan97 panicle, score: 83.41	N	N	N	N
vg0610802461	A -> G	LOC_Os06g18980.1	upstream_gene_variant ; 551.0bp to feature; MODIFIER	silent_mutation	Average:73.599; most accessible tissue: Zhenshan97 panicle, score: 83.41	N	N	N	N
vg0610802461	A -> G	LOC_Os06g18990.1	downstream_gene_variant ; 3890.0bp to feature; MODIFIER	silent_mutation	Average:73.599; most accessible tissue: Zhenshan97 panicle, score: 83.41	N	N	N	N
vg0610802461	A -> G	LOC_Os06g18970-LOC_Os06g18980	intergenic_region ; MODIFIER	silent_mutation	Average:73.599; most accessible tissue: Zhenshan97 panicle, score: 83.41	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610802461	NA	2.61E-10	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	1.23E-09	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	3.17E-10	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	6.97E-11	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	1.01E-11	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	1.34E-08	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	2.51E-09	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	9.36E-09	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	5.19E-08	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	1.36E-09	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	3.65E-09	mr1234	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	6.78E-06	1.02E-14	mr1244	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	2.68E-11	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	3.86E-10	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	6.16E-10	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	3.34E-10	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	4.62E-09	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	1.52E-09	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	2.75E-08	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	9.34E-09	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	2.08E-09	mr1112_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	3.50E-10	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	3.76E-09	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	3.35E-08	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	NA	1.22E-07	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802461	8.99E-06	2.58E-14	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251