\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610723942:

Variant ID: vg0610723942 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10723942
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAGACCGAATTTCAACGCAAATATGTCATGACCGACAAATTCGGTCTCGGTTCTGACCGAAATTTAACAATATTTTCATATATGCAAAAAAAAATAAT[A/G]
AAAATTTTCAACACAAAAATCACAAAAAAATTTGTAAGCATGTATGAGTAAAAACTCCTATTAGGTTGCATGTATAGAAGAAGTAAGGATGTGAAAATTA

Reverse complement sequence

TAATTTTCACATCCTTACTTCTTCTATACATGCAACCTAATAGGAGTTTTTACTCATACATGCTTACAAATTTTTTTGTGATTTTTGTGTTGAAAATTTT[T/C]
ATTATTTTTTTTTGCATATATGAAAATATTGTTAAATTTCGGTCAGAACCGAGACCGAATTTGTCGGTCATGACATATTTGCGTTGAAATTCGGTCTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.80% 10.90% 0.23% 0.00% NA
All Indica  2759 96.00% 3.60% 0.36% 0.00% NA
All Japonica  1512 72.90% 27.10% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.20% 1.70% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 93.00% 6.90% 0.11% 0.00% NA
Indica Intermediate  786 95.50% 3.40% 1.02% 0.00% NA
Temperate Japonica  767 51.10% 48.80% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 85.90% 14.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610723942 A -> G LOC_Os06g18870.1 downstream_gene_variant ; 652.0bp to feature; MODIFIER silent_mutation Average:50.03; most accessible tissue: Callus, score: 70.921 N N N N
vg0610723942 A -> G LOC_Os06g18880.1 downstream_gene_variant ; 2772.0bp to feature; MODIFIER silent_mutation Average:50.03; most accessible tissue: Callus, score: 70.921 N N N N
vg0610723942 A -> G LOC_Os06g18860-LOC_Os06g18870 intergenic_region ; MODIFIER silent_mutation Average:50.03; most accessible tissue: Callus, score: 70.921 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610723942 7.25E-11 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723942 1.27E-07 6.32E-11 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723942 NA 7.86E-07 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723942 NA 3.27E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723942 NA 1.36E-12 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723942 1.29E-15 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723942 8.71E-13 1.52E-20 mr1087_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723942 NA 3.61E-07 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723942 NA 4.36E-06 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723942 NA 2.29E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723942 NA 6.06E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723942 NA 2.87E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251