Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0610722873:

Variant ID: vg0610722873 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10722873
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.07, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTTGCAAAATTTACTCATTACATATTAATCTATGCTATTAATTTGTTTAATTTTATTAAAATCATTTAGTTGACATGTAATAAATAAGTGTACGCCAT[C/T]
TGAGTGATTAGAATCTCTCTCCATGGCACATGGCATACTTCTCTCTAGCTCAACGGGCCCAAAACAGCAACCCCCTTGCGTCCCTGGACACAGCCCTCCA

Reverse complement sequence

TGGAGGGCTGTGTCCAGGGACGCAAGGGGGTTGCTGTTTTGGGCCCGTTGAGCTAGAGAGAAGTATGCCATGTGCCATGGAGAGAGATTCTAATCACTCA[G/A]
ATGGCGTACACTTATTTATTACATGTCAACTAAATGATTTTAATAAAATTAAACAAATTAATAGCATAGATTAATATGTAATGAGTAAATTTTGCAAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.50% 34.40% 0.11% 0.00% NA
All Indica  2759 50.10% 49.80% 0.07% 0.00% NA
All Japonica  1512 88.40% 11.40% 0.13% 0.00% NA
Aus  269 83.60% 16.40% 0.00% 0.00% NA
Indica I  595 26.70% 72.90% 0.34% 0.00% NA
Indica II  465 78.30% 21.70% 0.00% 0.00% NA
Indica III  913 53.60% 46.40% 0.00% 0.00% NA
Indica Intermediate  786 47.20% 52.80% 0.00% 0.00% NA
Temperate Japonica  767 95.60% 4.40% 0.00% 0.00% NA
Tropical Japonica  504 75.20% 24.40% 0.40% 0.00% NA
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610722873 C -> T LOC_Os06g18860.1 upstream_gene_variant ; 4665.0bp to feature; MODIFIER silent_mutation Average:69.533; most accessible tissue: Zhenshan97 root, score: 83.426 N N N N
vg0610722873 C -> T LOC_Os06g18870.1 downstream_gene_variant ; 1721.0bp to feature; MODIFIER silent_mutation Average:69.533; most accessible tissue: Zhenshan97 root, score: 83.426 N N N N
vg0610722873 C -> T LOC_Os06g18880.1 downstream_gene_variant ; 3841.0bp to feature; MODIFIER silent_mutation Average:69.533; most accessible tissue: Zhenshan97 root, score: 83.426 N N N N
vg0610722873 C -> T LOC_Os06g18860-LOC_Os06g18870 intergenic_region ; MODIFIER silent_mutation Average:69.533; most accessible tissue: Zhenshan97 root, score: 83.426 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610722873 5.22E-11 NA mr1068 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 1.39E-07 1.39E-07 mr1068 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 2.01E-11 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 7.45E-06 NA mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 NA 3.26E-07 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 1.27E-21 NA mr1090 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 1.31E-09 1.14E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 2.06E-09 2.54E-13 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 4.13E-08 NA mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 3.64E-08 2.60E-10 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 4.06E-11 NA mr1096 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 1.67E-10 6.94E-13 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 1.08E-09 NA mr1111 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 5.93E-08 2.05E-10 mr1111 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 6.33E-10 NA mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 1.79E-07 3.29E-11 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 2.74E-09 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 9.54E-08 9.53E-08 mr1144 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 2.70E-19 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 1.13E-08 3.72E-09 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 1.44E-09 5.02E-12 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 7.37E-14 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 1.77E-09 2.64E-11 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 8.19E-06 NA mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 NA 2.02E-06 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 7.03E-12 NA mr1087_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 3.98E-07 4.12E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 1.76E-23 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 3.42E-08 1.29E-06 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 4.18E-16 3.26E-22 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 4.43E-10 NA mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 1.14E-08 2.34E-11 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 6.40E-11 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 1.15E-08 5.28E-11 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 1.13E-09 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 5.01E-09 5.01E-09 mr1111_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 1.30E-07 NA mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 NA 9.22E-08 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 1.03E-07 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 1.93E-06 1.09E-07 mr1144_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 3.62E-07 NA mr1200_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 NA 7.32E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 1.42E-18 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 3.30E-07 1.58E-07 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 3.80E-10 8.01E-14 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 1.93E-06 NA mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 2.41E-06 1.59E-07 mr1221_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610722873 5.50E-06 NA mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251