\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610642043:

Variant ID: vg0610642043 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 10642043
Reference Allele: GAlternative Allele: A,T,GCCCAGAAATTCACTAGTA
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTCGACATGTAGGCGTCTCGGTTCGTAGCCACTGCGTTCTCGTTGCCAGTTATTGGGGGACCGGTTGAGATCGGCATAGTGGTGTAAACCGGGTAGAC[G/A,T,GCCCAGAAATTCACTAGTA]
ATTTCGCCGACTTGAGTCCATACCAGCATTGTTGAAGTAGGAAGAACTTCACCGAAGCTGGTGTTGGCATTGTTGTCGACGAAGCTTGATGGCATAGTAG

Reverse complement sequence

CTACTATGCCATCAAGCTTCGTCGACAACAATGCCAACACCAGCTTCGGTGAAGTTCTTCCTACTTCAACAATGCTGGTATGGACTCAAGTCGGCGAAAT[C/T,A,TACTAGTGAATTTCTGGGC]
GTCTACCCGGTTTACACCACTATGCCGATCTCAACCGGTCCCCCAATAACTGGCAACGAGAACGCAGTGGCTACGAACCGAGACGCCTACATGTCGAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 4.40% 1.59% 4.63% T: 0.04%
All Indica  2759 89.20% 7.40% 1.70% 1.63% T: 0.07%
All Japonica  1512 88.40% 0.10% 1.12% 10.38% NA
Aus  269 93.70% 0.00% 3.35% 2.97% NA
Indica I  595 95.30% 1.80% 0.84% 2.02% NA
Indica II  465 97.00% 0.60% 1.29% 0.86% T: 0.22%
Indica III  913 82.00% 14.30% 2.19% 1.31% T: 0.11%
Indica Intermediate  786 88.20% 7.60% 2.04% 2.16% NA
Temperate Japonica  767 91.30% 0.00% 0.26% 8.47% NA
Tropical Japonica  504 82.30% 0.20% 2.38% 15.08% NA
Japonica Intermediate  241 92.10% 0.00% 1.24% 6.64% NA
VI/Aromatic  96 94.80% 2.10% 1.04% 2.08% NA
Intermediate  90 88.90% 2.20% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610642043 G -> GCCCAGAAATTCACTAGTA LOC_Os06g18770.1 disruptive_inframe_insertion ; p.Ile73_Val74insThrSerGluPheLe uGly; MODERATE N Average:16.194; most accessible tissue: Callus, score: 37.465 N N N N
vg0610642043 G -> T LOC_Os06g18770.1 synonymous_variant ; p.Ile73Ile; LOW synonymous_codon Average:16.194; most accessible tissue: Callus, score: 37.465 N N N N
vg0610642043 G -> A LOC_Os06g18770.1 synonymous_variant ; p.Ile73Ile; LOW synonymous_codon Average:16.194; most accessible tissue: Callus, score: 37.465 N N N N
vg0610642043 G -> DEL LOC_Os06g18770.1 N frameshift_variant Average:16.194; most accessible tissue: Callus, score: 37.465 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610642043 1.63E-08 1.02E-09 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 9.98E-11 1.64E-12 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 1.94E-12 1.92E-15 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 5.39E-12 3.21E-12 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 8.41E-11 5.21E-10 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 3.88E-12 4.76E-10 mr1094 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 1.36E-11 1.90E-11 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 2.58E-09 2.26E-10 mr1108 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 1.72E-07 1.09E-07 mr1110 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 1.24E-07 5.87E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 6.96E-09 1.45E-09 mr1112 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 2.62E-09 1.67E-08 mr1121 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 6.74E-08 9.79E-08 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 NA 9.04E-07 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 1.14E-07 2.38E-07 mr1211 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 1.19E-06 NA mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 3.22E-06 8.90E-08 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 NA 3.30E-07 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 NA 1.05E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 2.83E-06 1.62E-14 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 NA 2.47E-11 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 NA 3.12E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 NA 5.36E-08 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 NA 6.24E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 2.07E-06 NA mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642043 NA 3.84E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251