Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610635812:

Variant ID: vg0610635812 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10635812
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCGAACAAACTTCGCGTTCCACTTTCTTGTATTCTCGCTTGGAGGAGTACGTCATGGAGCCGCCGAAGATGTGTGAAACATGGAGGTCGGAGTCTGGGTA[C/T]
GCGAAGTCCGATTCGTGAGGAGGTGACTCCTCGTTTTTCTCGACAACGCGTACTCGCTTGCCTTTTTCAAACGCCATGTGCTTCTCGGGCGACTTTTTGA

Reverse complement sequence

TCAAAAAGTCGCCCGAGAAGCACATGGCGTTTGAAAAAGGCAAGCGAGTACGCGTTGTCGAGAAAAACGAGGAGTCACCTCCTCACGAATCGGACTTCGC[G/A]
TACCCAGACTCCGACCTCCATGTTTCACACATCTTCGGCGGCTCCATGACGTACTCCTCCAAGCGAGAATACAAGAAAGTGGAACGCGAAGTTTGTTCGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.00%	0.10%	16.02%	37.88%	NA
All Indica	2759	20.80%	0.20%	24.90%	54.11%	NA
All Japonica	1512	82.50%	0.00%	0.93%	16.60%	NA
Aus	269	83.60%	0.00%	12.64%	3.72%	NA
Indica I	595	18.30%	0.00%	4.87%	76.81%	NA
Indica II	465	5.80%	0.40%	14.19%	79.57%	NA
Indica III	913	26.00%	0.40%	42.83%	30.78%	NA
Indica Intermediate	786	25.40%	0.00%	25.57%	48.98%	NA
Temperate Japonica	767	87.60%	0.00%	0.13%	12.26%	NA
Tropical Japonica	504	71.00%	0.00%	1.59%	27.38%	NA
Japonica Intermediate	241	90.00%	0.00%	2.07%	7.88%	NA
VI/Aromatic	96	90.60%	0.00%	4.17%	5.21%	NA
Intermediate	90	45.60%	0.00%	20.00%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610635812	C -> T	LOC_Os06g18750.1	downstream_gene_variant ; 4590.0bp to feature; MODIFIER	silent_mutation	Average:11.895; most accessible tissue: Callus, score: 34.578	N	N	N	N
vg0610635812	C -> T	LOC_Os06g18750-LOC_Os06g18770	intergenic_region ; MODIFIER	silent_mutation	Average:11.895; most accessible tissue: Callus, score: 34.578	N	N	N	N
vg0610635812	C -> DEL	N	N	silent_mutation	Average:11.895; most accessible tissue: Callus, score: 34.578	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610635812	NA	5.90E-07	mr1002	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610635812	6.29E-06	NA	mr1065	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610635812	2.56E-08	NA	mr1087	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610635812	3.93E-09	3.73E-09	mr1087	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610635812	4.83E-07	NA	mr1091	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610635812	4.10E-06	NA	mr1094	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610635812	NA	3.26E-08	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610635812	2.51E-06	NA	mr1108	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610635812	1.13E-06	NA	mr1234	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610635812	NA	1.31E-09	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610635812	NA	3.14E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610635812	NA	9.81E-09	mr1465	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610635812	NA	1.72E-07	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610635812	NA	3.65E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610635812	NA	1.24E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610635812	NA	2.01E-29	mr1877	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610635812	NA	1.95E-08	mr1877	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610635812	NA	1.70E-08	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610635812	NA	1.35E-06	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251