\
| Variant ID: vg0610633502 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10633502 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CCCCTTTGACGATTAGTCGCTTGGCGCCAAGTGCGGCTGCATCTCGTATCCCGGCAAGTAGTCCTTCGTATTCTGCAGTGTTATTCGTTGCTCTGAAGTT[A/G]
AGGTGGATTGCGTGTTTGAATTGATCTCCGGATGGAGATGTTAAGATAAATCCAGCGCCTGCTCCTTGGCTATTGAGTGCACCATCGAACGCCATTGTCC
GGACAATGGCGTTCGATGGTGCACTCAATAGCCAAGGAGCAGGCGCTGGATTTATCTTAACATCTCCATCCGGAGATCAATTCAAACACGCAATCCACCT[T/C]
AACTTCAGAGCAACGAATAACACTGCAGAATACGAAGGACTACTTGCCGGGATACGAGATGCAGCCGCACTTGGCGCCAAGCGACTAATCGTCAAAGGGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.00% | 1.80% | 25.92% | 14.28% | NA |
| All Indica | 2759 | 65.50% | 2.50% | 30.23% | 1.78% | NA |
| All Japonica | 1512 | 49.70% | 0.30% | 9.79% | 40.21% | NA |
| Aus | 269 | 17.50% | 4.50% | 77.32% | 0.74% | NA |
| Indica I | 595 | 75.30% | 2.70% | 20.67% | 1.34% | NA |
| Indica II | 465 | 65.60% | 3.70% | 30.54% | 0.22% | NA |
| Indica III | 913 | 55.30% | 1.40% | 39.87% | 3.40% | NA |
| Indica Intermediate | 786 | 69.80% | 2.90% | 26.08% | 1.15% | NA |
| Temperate Japonica | 767 | 48.80% | 0.10% | 3.91% | 47.20% | NA |
| Tropical Japonica | 504 | 54.80% | 0.60% | 17.46% | 27.18% | NA |
| Japonica Intermediate | 241 | 42.30% | 0.00% | 12.45% | 45.23% | NA |
| VI/Aromatic | 96 | 75.00% | 0.00% | 17.71% | 7.29% | NA |
| Intermediate | 90 | 68.90% | 1.10% | 20.00% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610633502 | A -> G | LOC_Os06g18750.1 | downstream_gene_variant ; 2280.0bp to feature; MODIFIER | silent_mutation | Average:20.399; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0610633502 | A -> G | LOC_Os06g18750-LOC_Os06g18770 | intergenic_region ; MODIFIER | silent_mutation | Average:20.399; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0610633502 | A -> DEL | N | N | silent_mutation | Average:20.399; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610633502 | 1.88E-11 | NA | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610633502 | 1.70E-07 | 5.84E-10 | mr1087 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610633502 | NA | 2.19E-07 | mr1087 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610633502 | 2.25E-07 | NA | mr1096 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610633502 | 2.32E-06 | NA | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610633502 | 1.65E-06 | NA | mr1112 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610633502 | NA | 3.19E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610633502 | 8.07E-06 | 1.17E-07 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610633502 | 2.47E-10 | NA | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610633502 | 5.50E-06 | 1.05E-10 | mr1087_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610633502 | NA | 9.91E-07 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610633502 | NA | 4.38E-06 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |