Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0610628819:

Variant ID: vg0610628819 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10628819
Reference Allele: A	Alternative Allele: G,T
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTACTATTGCAATCAATTTCGGCCACACGGCCGAAAGTTGCCTCAACTCGATGAAACGATGACAGTGTAGATTGATTTCGGCTGTTTAGCCGAAATTCTT[A/G,T]
ATTTTGACGAAACAGTTATTACTAGATTAAACAAAATTCGGCCGTGATATGGCCGATTAGATCGTTCCCCAGCGGAGTCGCCAAAAATCGTGTTGGCAAC

Reverse complement sequence

GTTGCCAACACGATTTTTGGCGACTCCGCTGGGGAACGATCTAATCGGCCATATCACGGCCGAATTTTGTTTAATCTAGTAATAACTGTTTCGTCAAAAT[T/C,A]
AAGAATTTCGGCTAAACAGCCGAAATCAATCTACACTGTCATCGTTTCATCGAGTTGAGGCAACTTTCGGCCGTGTGGCCGAAATTGATTGCAATAGTAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.80%	45.60%	4.85%	3.41%	T: 0.30%
All Indica	2759	20.90%	73.40%	4.68%	0.62%	T: 0.40%
All Japonica	1512	82.50%	2.60%	5.56%	9.19%	T: 0.20%
Aus	269	82.90%	13.40%	3.35%	0.37%	NA
Indica I	595	20.30%	66.20%	10.92%	2.18%	T: 0.34%
Indica II	465	4.90%	92.00%	2.58%	0.22%	T: 0.22%
Indica III	913	24.80%	72.20%	2.30%	0.00%	T: 0.77%
Indica Intermediate	786	26.20%	69.30%	3.94%	0.38%	T: 0.13%
Temperate Japonica	767	87.90%	1.80%	6.52%	3.39%	T: 0.39%
Tropical Japonica	504	70.60%	3.60%	5.56%	20.24%	NA
Japonica Intermediate	241	90.00%	2.90%	2.49%	4.56%	NA
VI/Aromatic	96	86.50%	10.40%	2.08%	1.04%	NA
Intermediate	90	41.10%	50.00%	5.56%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610628819	A -> G	LOC_Os06g18740.1	upstream_gene_variant ; 924.0bp to feature; MODIFIER	silent_mutation	Average:19.301; most accessible tissue: Callus, score: 51.013	N	N	N	N
vg0610628819	A -> G	LOC_Os06g18750.1	upstream_gene_variant ; 819.0bp to feature; MODIFIER	silent_mutation	Average:19.301; most accessible tissue: Callus, score: 51.013	N	N	N	N
vg0610628819	A -> G	LOC_Os06g18740-LOC_Os06g18750	intergenic_region ; MODIFIER	silent_mutation	Average:19.301; most accessible tissue: Callus, score: 51.013	N	N	N	N
vg0610628819	A -> T	LOC_Os06g18740.1	upstream_gene_variant ; 924.0bp to feature; MODIFIER	silent_mutation	Average:19.301; most accessible tissue: Callus, score: 51.013	N	N	N	N
vg0610628819	A -> T	LOC_Os06g18750.1	upstream_gene_variant ; 819.0bp to feature; MODIFIER	silent_mutation	Average:19.301; most accessible tissue: Callus, score: 51.013	N	N	N	N
vg0610628819	A -> T	LOC_Os06g18740-LOC_Os06g18750	intergenic_region ; MODIFIER	silent_mutation	Average:19.301; most accessible tissue: Callus, score: 51.013	N	N	N	N
vg0610628819	A -> DEL	N	N	silent_mutation	Average:19.301; most accessible tissue: Callus, score: 51.013	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610628819	3.19E-06	NA	mr1087	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819	1.30E-06	NA	mr1111	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819	3.50E-06	7.70E-08	mr1111	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819	7.42E-08	NA	mr1144	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819	1.14E-06	1.20E-07	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819	7.54E-06	NA	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819	9.53E-06	NA	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819	NA	8.10E-07	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819	NA	2.67E-06	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819	NA	1.18E-07	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819	1.41E-07	NA	mr1111_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819	1.26E-06	1.36E-06	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819	NA	7.71E-06	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819	1.80E-06	NA	mr1144_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819	NA	2.22E-06	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251