\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610628819:

Variant ID: vg0610628819 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10628819
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTACTATTGCAATCAATTTCGGCCACACGGCCGAAAGTTGCCTCAACTCGATGAAACGATGACAGTGTAGATTGATTTCGGCTGTTTAGCCGAAATTCTT[A/G,T]
ATTTTGACGAAACAGTTATTACTAGATTAAACAAAATTCGGCCGTGATATGGCCGATTAGATCGTTCCCCAGCGGAGTCGCCAAAAATCGTGTTGGCAAC

Reverse complement sequence

GTTGCCAACACGATTTTTGGCGACTCCGCTGGGGAACGATCTAATCGGCCATATCACGGCCGAATTTTGTTTAATCTAGTAATAACTGTTTCGTCAAAAT[T/C,A]
AAGAATTTCGGCTAAACAGCCGAAATCAATCTACACTGTCATCGTTTCATCGAGTTGAGGCAACTTTCGGCCGTGTGGCCGAAATTGATTGCAATAGTAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.80% 45.60% 4.85% 3.41% T: 0.30%
All Indica  2759 20.90% 73.40% 4.68% 0.62% T: 0.40%
All Japonica  1512 82.50% 2.60% 5.56% 9.19% T: 0.20%
Aus  269 82.90% 13.40% 3.35% 0.37% NA
Indica I  595 20.30% 66.20% 10.92% 2.18% T: 0.34%
Indica II  465 4.90% 92.00% 2.58% 0.22% T: 0.22%
Indica III  913 24.80% 72.20% 2.30% 0.00% T: 0.77%
Indica Intermediate  786 26.20% 69.30% 3.94% 0.38% T: 0.13%
Temperate Japonica  767 87.90% 1.80% 6.52% 3.39% T: 0.39%
Tropical Japonica  504 70.60% 3.60% 5.56% 20.24% NA
Japonica Intermediate  241 90.00% 2.90% 2.49% 4.56% NA
VI/Aromatic  96 86.50% 10.40% 2.08% 1.04% NA
Intermediate  90 41.10% 50.00% 5.56% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610628819 A -> G LOC_Os06g18740.1 upstream_gene_variant ; 924.0bp to feature; MODIFIER silent_mutation Average:19.301; most accessible tissue: Callus, score: 51.013 N N N N
vg0610628819 A -> G LOC_Os06g18750.1 upstream_gene_variant ; 819.0bp to feature; MODIFIER silent_mutation Average:19.301; most accessible tissue: Callus, score: 51.013 N N N N
vg0610628819 A -> G LOC_Os06g18740-LOC_Os06g18750 intergenic_region ; MODIFIER silent_mutation Average:19.301; most accessible tissue: Callus, score: 51.013 N N N N
vg0610628819 A -> T LOC_Os06g18740.1 upstream_gene_variant ; 924.0bp to feature; MODIFIER silent_mutation Average:19.301; most accessible tissue: Callus, score: 51.013 N N N N
vg0610628819 A -> T LOC_Os06g18750.1 upstream_gene_variant ; 819.0bp to feature; MODIFIER silent_mutation Average:19.301; most accessible tissue: Callus, score: 51.013 N N N N
vg0610628819 A -> T LOC_Os06g18740-LOC_Os06g18750 intergenic_region ; MODIFIER silent_mutation Average:19.301; most accessible tissue: Callus, score: 51.013 N N N N
vg0610628819 A -> DEL N N silent_mutation Average:19.301; most accessible tissue: Callus, score: 51.013 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610628819 3.19E-06 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819 1.30E-06 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819 3.50E-06 7.70E-08 mr1111 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819 7.42E-08 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819 1.14E-06 1.20E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819 7.54E-06 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819 9.53E-06 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819 NA 8.10E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819 NA 2.67E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819 NA 1.18E-07 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819 1.41E-07 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819 1.26E-06 1.36E-06 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819 NA 7.71E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819 1.80E-06 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610628819 NA 2.22E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251