\
| Variant ID: vg0610548373 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10548373 |
| Reference Allele: A | Alternative Allele: C,T |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.82, C: 0.18, others allele: 0.00, population size: 49. )
AACCCTGGTAATTGATAGCAAAATTTTTGAAATAATTTTGATGCCAAAATTTGTGAATTTAATTTTGAAATAATTTGATTGGTAGCAAAATAATACACGT[A/C,T]
TGTGAATTTAAATATGCATCAATTCAAAATAATATTGTGTGAGCAAACAATACAAAATGATGTTGTTTGAGAAAAAAGGTTGCCCAGGGATAAGATTGTC
GACAATCTTATCCCTGGGCAACCTTTTTTCTCAAACAACATCATTTTGTATTGTTTGCTCACACAATATTATTTTGAATTGATGCATATTTAAATTCACA[T/G,A]
ACGTGTATTATTTTGCTACCAATCAAATTATTTCAAAATTAAATTCACAAATTTTGGCATCAAAATTATTTCAAAAATTTTGCTATCAATTACCAGGGTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.10% | 26.70% | 0.70% | 42.47% | T: 0.04% |
| All Indica | 2759 | 28.70% | 44.10% | 0.69% | 26.50% | NA |
| All Japonica | 1512 | 35.80% | 1.30% | 0.73% | 62.24% | NA |
| Aus | 269 | 17.80% | 0.40% | 1.12% | 80.67% | NA |
| Indica I | 595 | 17.00% | 75.80% | 0.34% | 6.89% | NA |
| Indica II | 465 | 18.30% | 71.80% | 0.43% | 9.46% | NA |
| Indica III | 913 | 41.70% | 14.80% | 0.66% | 42.83% | NA |
| Indica Intermediate | 786 | 28.60% | 37.80% | 1.15% | 32.44% | NA |
| Temperate Japonica | 767 | 50.20% | 1.40% | 0.91% | 47.46% | NA |
| Tropical Japonica | 504 | 22.20% | 0.80% | 0.20% | 76.79% | NA |
| Japonica Intermediate | 241 | 18.30% | 1.70% | 1.24% | 78.84% | NA |
| VI/Aromatic | 96 | 9.40% | 1.00% | 0.00% | 89.58% | NA |
| Intermediate | 90 | 34.40% | 27.80% | 0.00% | 35.56% | T: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610548373 | A -> C | LOC_Os06g18120.1 | upstream_gene_variant ; 1525.0bp to feature; MODIFIER | silent_mutation | Average:27.871; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0610548373 | A -> C | LOC_Os06g18140.1 | upstream_gene_variant ; 4936.0bp to feature; MODIFIER | silent_mutation | Average:27.871; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0610548373 | A -> C | LOC_Os06g18110.1 | downstream_gene_variant ; 320.0bp to feature; MODIFIER | silent_mutation | Average:27.871; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0610548373 | A -> C | LOC_Os06g18130.1 | downstream_gene_variant ; 3265.0bp to feature; MODIFIER | silent_mutation | Average:27.871; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0610548373 | A -> C | LOC_Os06g18110-LOC_Os06g18120 | intergenic_region ; MODIFIER | silent_mutation | Average:27.871; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0610548373 | A -> T | LOC_Os06g18120.1 | upstream_gene_variant ; 1525.0bp to feature; MODIFIER | silent_mutation | Average:27.871; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0610548373 | A -> T | LOC_Os06g18140.1 | upstream_gene_variant ; 4936.0bp to feature; MODIFIER | silent_mutation | Average:27.871; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0610548373 | A -> T | LOC_Os06g18110.1 | downstream_gene_variant ; 320.0bp to feature; MODIFIER | silent_mutation | Average:27.871; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0610548373 | A -> T | LOC_Os06g18130.1 | downstream_gene_variant ; 3265.0bp to feature; MODIFIER | silent_mutation | Average:27.871; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0610548373 | A -> T | LOC_Os06g18110-LOC_Os06g18120 | intergenic_region ; MODIFIER | silent_mutation | Average:27.871; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0610548373 | A -> DEL | N | N | silent_mutation | Average:27.871; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610548373 | 3.98E-12 | 3.38E-69 | mr1065 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 2.66E-12 | 1.85E-24 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 2.94E-11 | 2.34E-62 | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.59E-09 | 4.61E-23 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 3.79E-07 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 6.56E-10 | NA | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 2.92E-10 | 2.52E-16 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 3.42E-13 | 8.78E-66 | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.33E-11 | 3.09E-26 | mr1091 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 9.18E-06 | NA | mr1096 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 1.57E-07 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 7.20E-12 | 8.01E-63 | mr1108 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.36E-10 | 1.63E-22 | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 3.52E-09 | 2.39E-50 | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 5.07E-07 | 6.07E-16 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.39E-10 | 2.61E-59 | mr1112 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 2.13E-08 | 4.12E-20 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 1.16E-07 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 2.08E-08 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 1.24E-08 | mr1215 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 2.16E-07 | 3.89E-24 | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.96E-08 | 6.43E-16 | mr1218 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 5.77E-09 | 1.36E-42 | mr1221 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 7.54E-10 | 6.15E-19 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 8.57E-11 | 2.60E-65 | mr1234 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.35E-07 | 5.94E-20 | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 8.40E-33 | mr1237 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 5.58E-08 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 1.72E-08 | mr1242 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 2.93E-07 | 2.72E-27 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 6.41E-08 | 3.27E-14 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 7.92E-10 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.08E-06 | 7.74E-29 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.18E-07 | 1.22E-18 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 4.63E-10 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 4.85E-06 | 4.85E-06 | mr1850 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 2.17E-06 | 9.70E-35 | mr1877 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 4.75E-10 | mr1877 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 8.71E-19 | 7.69E-88 | mr1065_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.39E-19 | 4.91E-32 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.75E-17 | 7.57E-76 | mr1067_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 8.75E-15 | 4.45E-27 | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 5.70E-07 | NA | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 6.99E-06 | NA | mr1072_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 4.33E-06 | NA | mr1072_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 9.53E-06 | NA | mr1075_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.98E-06 | NA | mr1077_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 3.24E-06 | NA | mr1077_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 4.22E-07 | NA | mr1078_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 2.66E-08 | 4.25E-11 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 5.27E-12 | NA | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.33E-12 | 2.96E-19 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.78E-16 | 7.50E-79 | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 3.90E-14 | 1.13E-29 | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.22E-06 | NA | mr1096_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 4.43E-08 | 1.56E-07 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 3.96E-16 | 8.69E-78 | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.56E-14 | 7.72E-26 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 2.95E-12 | 3.00E-58 | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 7.46E-11 | 3.43E-19 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 7.80E-17 | 1.04E-80 | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.11E-15 | 1.25E-26 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 3.35E-06 | NA | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 1.89E-11 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 6.30E-06 | NA | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 3.04E-06 | mr1197_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 7.70E-06 | NA | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 1.05E-09 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 1.20E-06 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 2.64E-32 | mr1218_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 3.91E-06 | 1.17E-18 | mr1218_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 6.49E-10 | 1.76E-57 | mr1221_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.81E-10 | 1.80E-26 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 5.03E-19 | 2.27E-88 | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 8.83E-16 | 1.87E-29 | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 3.81E-10 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 8.26E-26 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 2.62E-09 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.87E-09 | NA | mr1526_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 2.01E-10 | 1.77E-16 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 5.89E-07 | 1.05E-24 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 1.16E-06 | 1.25E-18 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 4.77E-06 | 2.02E-23 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | 9.51E-07 | 1.43E-20 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 7.25E-32 | mr1877_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610548373 | NA | 2.66E-10 | mr1877_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |