\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610539400:

Variant ID: vg0610539400 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10539400
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, G: 0.13, others allele: 0.00, population size: 38. )

Flanking Sequence (100 bp) in Reference Genome:


ACGAAAGACTTCCAAGTCTACTGTGATGCATCTCGCCAAGGACTAGGATGTGTTTTGATGCAGGAAGGTAGAGTGGTCGCATATGCTTCACGGCAGTTGC[A/G]
TCCACATGACAGCAATTATCCTACTCATGATCTGGAGTTGGCAGCAGTGGTTCACGCTCTGAAAATCTGGCGGCACTATCTTATTGGCAACCTCTGTGAA

Reverse complement sequence

TTCACAGAGGTTGCCAATAAGATAGTGCCGCCAGATTTTCAGAGCGTGAACCACTGCTGCCAACTCCAGATCATGAGTAGGATAATTGCTGTCATGTGGA[T/C]
GCAACTGCCGTGAAGCATATGCGACCACTCTACCTTCCTGCATCAAAACACATCCTAGTCCTTGGCGAGATGCATCACAGTAGACTTGGAAGTCTTTCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.20% 27.70% 6.83% 30.26% NA
All Indica  2759 56.90% 17.50% 6.49% 19.10% NA
All Japonica  1512 3.70% 46.50% 6.88% 42.92% NA
Aus  269 1.50% 25.30% 8.18% 65.06% NA
Indica I  595 81.00% 12.80% 3.03% 3.19% NA
Indica II  465 72.90% 17.80% 1.51% 7.74% NA
Indica III  913 39.90% 18.90% 9.97% 31.22% NA
Indica Intermediate  786 49.00% 19.20% 8.02% 23.79% NA
Temperate Japonica  767 2.10% 58.90% 5.61% 33.38% NA
Tropical Japonica  504 5.80% 35.70% 7.54% 50.99% NA
Japonica Intermediate  241 4.60% 29.50% 9.54% 56.43% NA
VI/Aromatic  96 4.20% 26.00% 9.38% 60.42% NA
Intermediate  90 34.40% 32.20% 10.00% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610539400 A -> G LOC_Os06g18100.1 missense_variant ; p.His119Arg; MODERATE nonsynonymous_codon ; H119C Average:46.336; most accessible tissue: Minghui63 flag leaf, score: 60.569 benign 0.05 DELETERIOUS 0.01
vg0610539400 A -> G LOC_Os06g18100.1 missense_variant ; p.His119Arg; MODERATE nonsynonymous_codon ; H119R Average:46.336; most accessible tissue: Minghui63 flag leaf, score: 60.569 benign -1.048 TOLERATED 1.00
vg0610539400 A -> DEL LOC_Os06g18100.1 N frameshift_variant Average:46.336; most accessible tissue: Minghui63 flag leaf, score: 60.569 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610539400 NA 1.03E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 2.37E-07 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 3.07E-06 2.04E-09 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 5.00E-10 NA mr1211 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 1.11E-07 1.70E-12 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 NA 1.42E-09 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 NA 9.17E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 NA 6.45E-07 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 NA 4.09E-18 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 NA 3.85E-10 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 NA 1.06E-10 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 1.54E-06 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 8.66E-08 4.03E-14 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 NA 4.10E-14 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 NA 3.16E-08 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 NA 1.93E-17 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 NA 3.38E-12 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 NA 4.85E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 NA 5.77E-15 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610539400 NA 5.29E-10 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251