\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610533263:

Variant ID: vg0610533263 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10533263
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


ATGCATCTATTTCATGCATTAAGTTATTGCTTAGTCAGTGTCATGAGTATCTTTGTTTGGGTCCATGAAAAATGTTCCATGCATAAAAATCATCATGGTC[G/A]
GTTATTTATTTGAGTCATTTGTCGTTTTGTTTAAATTTGGATTTGAGCATGCGTTGATTCCTATCCTTTTCCTACCTTAGATGTCAGGTCTGTTCTCCGA

Reverse complement sequence

TCGGAGAACAGACCTGACATCTAAGGTAGGAAAAGGATAGGAATCAACGCATGCTCAAATCCAAATTTAAACAAAACGACAAATGACTCAAATAAATAAC[C/T]
GACCATGATGATTTTTATGCATGGAACATTTTTCATGGACCCAAACAAAGATACTCATGACACTGACTAAGCAATAACTTAATGCATGAAATAGATGCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.20% 9.70% 1.50% 40.61% NA
All Indica  2759 61.40% 11.60% 1.41% 25.59% NA
All Japonica  1512 30.70% 8.50% 1.79% 59.06% NA
Aus  269 21.60% 0.40% 0.74% 77.32% NA
Indica I  595 93.30% 0.00% 0.00% 6.72% NA
Indica II  465 75.30% 15.10% 0.22% 9.46% NA
Indica III  913 39.20% 17.30% 1.86% 41.62% NA
Indica Intermediate  786 54.80% 11.70% 2.67% 30.79% NA
Temperate Japonica  767 38.60% 15.80% 2.48% 43.16% NA
Tropical Japonica  504 23.60% 0.60% 1.19% 74.60% NA
Japonica Intermediate  241 20.30% 1.70% 0.83% 77.18% NA
VI/Aromatic  96 11.50% 1.00% 3.12% 84.38% NA
Intermediate  90 55.60% 10.00% 0.00% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610533263 G -> A LOC_Os06g18090.1 upstream_gene_variant ; 368.0bp to feature; MODIFIER silent_mutation Average:39.452; most accessible tissue: Callus, score: 70.826 N N N N
vg0610533263 G -> A LOC_Os06g18080.1 downstream_gene_variant ; 3309.0bp to feature; MODIFIER silent_mutation Average:39.452; most accessible tissue: Callus, score: 70.826 N N N N
vg0610533263 G -> A LOC_Os06g18080-LOC_Os06g18090 intergenic_region ; MODIFIER silent_mutation Average:39.452; most accessible tissue: Callus, score: 70.826 N N N N
vg0610533263 G -> DEL N N silent_mutation Average:39.452; most accessible tissue: Callus, score: 70.826 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610533263 1.79E-07 3.87E-08 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 1.91E-08 1.68E-12 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 7.15E-06 2.47E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 4.08E-06 NA mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 3.10E-06 NA mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 2.78E-07 1.83E-09 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 NA 1.84E-08 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 NA 6.17E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 1.59E-07 NA mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 9.28E-09 NA mr1211 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 5.09E-11 5.45E-14 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 NA 8.65E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 NA 2.23E-06 mr1672 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 1.13E-08 NA mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 4.88E-12 2.32E-14 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 2.48E-06 7.21E-08 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 2.89E-06 3.96E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 4.53E-08 NA mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 9.91E-09 7.58E-11 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 4.79E-07 NA mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533263 3.05E-13 1.23E-16 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251