\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610532353:

Variant ID: vg0610532353 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10532353
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.63, G: 0.37, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


CGCGGTTATGGGCGGTCGACTAGATTCACCGTGATTAGTCTCACCCCTAGTTAGCTAATGAACTAGTGTAGTTCAGGTGGTTGGTTGGGCCTGTTGCAAC[A/G]
TGGTGTAATGTTGGACAGTGATTGGTTAATATTGATTAATTACTACAACTGTTTTACGGCTTTCAACTACTGCTTTTAAATTCTTAAATTCCTGCTTTAT

Reverse complement sequence

ATAAAGCAGGAATTTAAGAATTTAAAAGCAGTAGTTGAAAGCCGTAAAACAGTTGTAGTAATTAATCAATATTAACCAATCACTGTCCAACATTACACCA[T/C]
GTTGCAACAGGCCCAACCAACCACCTGAACTACACTAGTTCATTAGCTAACTAGGGGTGAGACTAATCACGGTGAATCTAGTCGACCGCCCATAACCGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.20% 9.20% 1.42% 40.18% NA
All Indica  2759 58.20% 15.30% 0.80% 25.73% NA
All Japonica  1512 39.40% 0.30% 1.92% 58.47% NA
Aus  269 22.30% 0.40% 5.20% 72.12% NA
Indica I  595 88.70% 4.50% 0.17% 6.55% NA
Indica II  465 89.70% 0.90% 0.00% 9.46% NA
Indica III  913 26.50% 30.40% 0.88% 42.17% NA
Indica Intermediate  786 53.30% 14.20% 1.65% 30.79% NA
Temperate Japonica  767 54.80% 0.10% 2.48% 42.63% NA
Tropical Japonica  504 24.20% 0.20% 0.99% 74.60% NA
Japonica Intermediate  241 22.00% 0.80% 2.07% 75.10% NA
VI/Aromatic  96 11.50% 3.10% 2.08% 83.33% NA
Intermediate  90 60.00% 5.60% 0.00% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610532353 A -> G LOC_Os06g18090.1 upstream_gene_variant ; 1278.0bp to feature; MODIFIER silent_mutation Average:43.809; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N
vg0610532353 A -> G LOC_Os06g18080.1 downstream_gene_variant ; 2399.0bp to feature; MODIFIER silent_mutation Average:43.809; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N
vg0610532353 A -> G LOC_Os06g18080-LOC_Os06g18090 intergenic_region ; MODIFIER silent_mutation Average:43.809; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N
vg0610532353 A -> DEL N N silent_mutation Average:43.809; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610532353 NA 1.03E-09 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 6.82E-07 7.51E-14 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 6.79E-11 4.40E-18 mr1087 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 2.72E-07 1.37E-12 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 3.70E-07 3.64E-11 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 2.87E-07 2.94E-10 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 4.77E-09 2.17E-13 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 3.39E-09 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 2.03E-08 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 5.71E-08 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 2.94E-10 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 2.63E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 5.06E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 2.86E-07 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 3.71E-06 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 3.68E-08 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 5.69E-08 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 3.45E-07 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 1.04E-06 5.58E-11 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 6.50E-06 2.73E-13 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 1.05E-07 1.25E-16 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 1.63E-07 9.79E-15 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 1.86E-06 4.06E-11 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 3.10E-09 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 1.53E-06 2.36E-12 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 7.43E-09 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 8.55E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 2.22E-09 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 1.46E-08 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 7.21E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 3.94E-09 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 4.46E-07 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 4.99E-09 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 4.65E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532353 NA 1.38E-10 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251