\
| Variant ID: vg0610480987 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10480987 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGGATATGTTTTAGTGAGTTTAAATCTCTATAAATAGTACTCCCTCCGTTTCAAAATATTTGACACCGTTGACTTTTTAGCACATGTTTAACCATTCGTC[A/T]
AATTCAAAAAAATTTGTGAAATATGTAAAACTATGTGTACATGAAAGTATATTTAACAATGAATCAAATGATATAAAAAAATAAATAATTACTTAAATTT
AAATTTAAGTAATTATTTATTTTTTTATATCATTTGATTCATTGTTAAATATACTTTCATGTACACATAGTTTTACATATTTCACAAATTTTTTTGAATT[T/A]
GACGAATGGTTAAACATGTGCTAAAAAGTCAACGGTGTCAAATATTTTGAAACGGAGGGAGTACTATTTATAGAGATTTAAACTCACTAAAACATATCCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.40% | 9.90% | 0.17% | 42.55% | NA |
| All Indica | 2759 | 72.00% | 0.80% | 0.07% | 27.18% | NA |
| All Japonica | 1512 | 9.90% | 28.90% | 0.26% | 60.91% | NA |
| Aus | 269 | 16.70% | 1.50% | 0.00% | 81.78% | NA |
| Indica I | 595 | 92.10% | 1.20% | 0.00% | 6.72% | NA |
| Indica II | 465 | 89.70% | 0.90% | 0.00% | 9.46% | NA |
| Indica III | 913 | 55.60% | 0.10% | 0.00% | 44.25% | NA |
| Indica Intermediate | 786 | 65.30% | 1.10% | 0.25% | 33.33% | NA |
| Temperate Japonica | 767 | 2.90% | 51.40% | 0.26% | 45.50% | NA |
| Tropical Japonica | 504 | 22.80% | 0.80% | 0.00% | 76.39% | NA |
| Japonica Intermediate | 241 | 5.40% | 16.20% | 0.83% | 77.59% | NA |
| VI/Aromatic | 96 | 7.30% | 0.00% | 1.04% | 91.67% | NA |
| Intermediate | 90 | 56.70% | 6.70% | 1.11% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610480987 | A -> T | LOC_Os06g18010.1 | downstream_gene_variant ; 85.0bp to feature; MODIFIER | silent_mutation | Average:54.157; most accessible tissue: Minghui63 flower, score: 72.046 | N | N | N | N |
| vg0610480987 | A -> T | LOC_Os06g18010-LOC_Os06g18020 | intergenic_region ; MODIFIER | silent_mutation | Average:54.157; most accessible tissue: Minghui63 flower, score: 72.046 | N | N | N | N |
| vg0610480987 | A -> DEL | N | N | silent_mutation | Average:54.157; most accessible tissue: Minghui63 flower, score: 72.046 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610480987 | 3.62E-11 | NA | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610480987 | 2.49E-06 | 1.42E-09 | mr1087 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610480987 | NA | 9.11E-06 | mr1096 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610480987 | NA | 7.10E-13 | mr1844 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610480987 | NA | 1.13E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610480987 | 5.23E-19 | NA | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610480987 | 2.29E-11 | 1.66E-20 | mr1087_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610480987 | 3.30E-06 | NA | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610480987 | NA | 5.69E-08 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610480987 | NA | 3.32E-06 | mr1094_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610480987 | NA | 7.22E-07 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610480987 | NA | 4.06E-13 | mr1844_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610480987 | NA | 3.18E-06 | mr1844_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |