Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0610446203:

Variant ID: vg0610446203 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10446203
Reference Allele: G	Alternative Allele: C,T
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCAAGGTTGCTTCGGTTGCCGCAGAAAAGATGGTCTTGCTGCTGGGAGTGCAGAAGGAGATATGGTGAGCATCTGAATTGCAGCCTAATTAATTTTATTT[G/C,T]
TCATTTGCATTAGATTTATTGGGACCACACTTATGCAGAGTGGTATGGTACTCAGTTTATTTTTAATGATTTATTTATATTTTTTATTACATATCCTGGA

Reverse complement sequence

TCCAGGATATGTAATAAAAAATATAAATAAATCATTAAAAATAAACTGAGTACCATACCACTCTGCATAAGTGTGGTCCCAATAAATCTAATGCAAATGA[C/G,A]
AAATAAAATTAATTAGGCTGCAATTCAGATGCTCACCATATCTCCTTCTGCACTCCCAGCAGCAAGACCATCTTTTCTGCGGCAACCGAAGCAACCTTGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.60%	21.60%	5.16%	47.27%	T: 0.36%
All Indica	2759	7.40%	12.70%	6.31%	73.21%	T: 0.40%
All Japonica	1512	45.30%	42.00%	4.23%	8.07%	T: 0.40%
Aus	269	82.20%	1.90%	1.49%	14.50%	NA
Indica I	595	8.40%	12.90%	2.18%	76.13%	T: 0.34%
Indica II	465	1.50%	4.10%	4.95%	89.25%	T: 0.22%
Indica III	913	6.50%	15.40%	8.00%	69.55%	T: 0.55%
Indica Intermediate	786	11.20%	14.40%	8.27%	65.78%	T: 0.38%
Temperate Japonica	767	42.50%	46.50%	4.69%	5.61%	T: 0.65%
Tropical Japonica	504	46.80%	42.70%	2.78%	7.74%	NA
Japonica Intermediate	241	51.00%	26.10%	5.81%	16.60%	T: 0.41%
VI/Aromatic	96	78.10%	7.30%	0.00%	14.58%	NA
Intermediate	90	26.70%	27.80%	2.22%	43.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610446203	G -> C	LOC_Os06g17960.1	upstream_gene_variant ; 3156.0bp to feature; MODIFIER	silent_mutation	Average:14.925; most accessible tissue: Callus, score: 88.215	N	N	N	N
vg0610446203	G -> C	LOC_Os06g17950.1	downstream_gene_variant ; 4296.0bp to feature; MODIFIER	silent_mutation	Average:14.925; most accessible tissue: Callus, score: 88.215	N	N	N	N
vg0610446203	G -> C	LOC_Os06g17970.1	intron_variant ; MODIFIER	silent_mutation	Average:14.925; most accessible tissue: Callus, score: 88.215	N	N	N	N
vg0610446203	G -> T	LOC_Os06g17960.1	upstream_gene_variant ; 3156.0bp to feature; MODIFIER	silent_mutation	Average:14.925; most accessible tissue: Callus, score: 88.215	N	N	N	N
vg0610446203	G -> T	LOC_Os06g17950.1	downstream_gene_variant ; 4296.0bp to feature; MODIFIER	silent_mutation	Average:14.925; most accessible tissue: Callus, score: 88.215	N	N	N	N
vg0610446203	G -> T	LOC_Os06g17970.1	intron_variant ; MODIFIER	silent_mutation	Average:14.925; most accessible tissue: Callus, score: 88.215	N	N	N	N
vg0610446203	G -> DEL	N	N	silent_mutation	Average:14.925; most accessible tissue: Callus, score: 88.215	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610446203	NA	3.02E-10	mr1065	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	1.60E-12	NA	mr1068	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	5.35E-11	4.52E-21	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	5.88E-08	NA	mr1078	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	1.15E-09	1.47E-13	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	5.90E-07	2.71E-13	mr1087	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	4.03E-07	NA	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	2.57E-06	1.39E-15	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	3.58E-06	3.56E-12	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	1.98E-06	6.88E-14	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	5.08E-09	mr1108	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	5.73E-09	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	2.04E-06	5.56E-14	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	1.09E-09	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	1.96E-10	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	6.24E-09	1.58E-15	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	8.44E-07	2.36E-10	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	2.32E-08	NA	mr1211	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	1.94E-06	3.61E-13	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	1.36E-08	mr1234	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	1.22E-11	mr1244	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	1.53E-10	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	2.00E-16	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	9.74E-08	NA	mr1078_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	4.26E-06	3.79E-16	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	1.52E-12	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	1.77E-17	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	2.81E-10	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	5.41E-12	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	1.26E-08	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	7.58E-11	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	1.54E-08	mr1112_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	7.33E-12	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	6.70E-10	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	6.87E-10	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	5.33E-06	NA	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	2.17E-15	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	5.79E-10	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203	NA	3.65E-10	mr1526_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251