\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610446203:

Variant ID: vg0610446203 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10446203
Reference Allele: GAlternative Allele: C,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAAGGTTGCTTCGGTTGCCGCAGAAAAGATGGTCTTGCTGCTGGGAGTGCAGAAGGAGATATGGTGAGCATCTGAATTGCAGCCTAATTAATTTTATTT[G/C,T]
TCATTTGCATTAGATTTATTGGGACCACACTTATGCAGAGTGGTATGGTACTCAGTTTATTTTTAATGATTTATTTATATTTTTTATTACATATCCTGGA

Reverse complement sequence

TCCAGGATATGTAATAAAAAATATAAATAAATCATTAAAAATAAACTGAGTACCATACCACTCTGCATAAGTGTGGTCCCAATAAATCTAATGCAAATGA[C/G,A]
AAATAAAATTAATTAGGCTGCAATTCAGATGCTCACCATATCTCCTTCTGCACTCCCAGCAGCAAGACCATCTTTTCTGCGGCAACCGAAGCAACCTTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.60% 21.60% 5.16% 47.27% T: 0.36%
All Indica  2759 7.40% 12.70% 6.31% 73.21% T: 0.40%
All Japonica  1512 45.30% 42.00% 4.23% 8.07% T: 0.40%
Aus  269 82.20% 1.90% 1.49% 14.50% NA
Indica I  595 8.40% 12.90% 2.18% 76.13% T: 0.34%
Indica II  465 1.50% 4.10% 4.95% 89.25% T: 0.22%
Indica III  913 6.50% 15.40% 8.00% 69.55% T: 0.55%
Indica Intermediate  786 11.20% 14.40% 8.27% 65.78% T: 0.38%
Temperate Japonica  767 42.50% 46.50% 4.69% 5.61% T: 0.65%
Tropical Japonica  504 46.80% 42.70% 2.78% 7.74% NA
Japonica Intermediate  241 51.00% 26.10% 5.81% 16.60% T: 0.41%
VI/Aromatic  96 78.10% 7.30% 0.00% 14.58% NA
Intermediate  90 26.70% 27.80% 2.22% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610446203 G -> C LOC_Os06g17960.1 upstream_gene_variant ; 3156.0bp to feature; MODIFIER silent_mutation Average:14.925; most accessible tissue: Callus, score: 88.215 N N N N
vg0610446203 G -> C LOC_Os06g17950.1 downstream_gene_variant ; 4296.0bp to feature; MODIFIER silent_mutation Average:14.925; most accessible tissue: Callus, score: 88.215 N N N N
vg0610446203 G -> C LOC_Os06g17970.1 intron_variant ; MODIFIER silent_mutation Average:14.925; most accessible tissue: Callus, score: 88.215 N N N N
vg0610446203 G -> T LOC_Os06g17960.1 upstream_gene_variant ; 3156.0bp to feature; MODIFIER silent_mutation Average:14.925; most accessible tissue: Callus, score: 88.215 N N N N
vg0610446203 G -> T LOC_Os06g17950.1 downstream_gene_variant ; 4296.0bp to feature; MODIFIER silent_mutation Average:14.925; most accessible tissue: Callus, score: 88.215 N N N N
vg0610446203 G -> T LOC_Os06g17970.1 intron_variant ; MODIFIER silent_mutation Average:14.925; most accessible tissue: Callus, score: 88.215 N N N N
vg0610446203 G -> DEL N N silent_mutation Average:14.925; most accessible tissue: Callus, score: 88.215 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610446203 NA 3.02E-10 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 1.60E-12 NA mr1068 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 5.35E-11 4.52E-21 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 5.88E-08 NA mr1078 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 1.15E-09 1.47E-13 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 5.90E-07 2.71E-13 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 4.03E-07 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 2.57E-06 1.39E-15 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 3.58E-06 3.56E-12 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 1.98E-06 6.88E-14 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 5.08E-09 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 5.73E-09 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 2.04E-06 5.56E-14 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 1.09E-09 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 1.96E-10 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 6.24E-09 1.58E-15 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 8.44E-07 2.36E-10 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 2.32E-08 NA mr1211 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 1.94E-06 3.61E-13 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 1.36E-08 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 1.22E-11 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 1.53E-10 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 2.00E-16 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 9.74E-08 NA mr1078_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 4.26E-06 3.79E-16 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 1.52E-12 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 1.77E-17 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 2.81E-10 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 5.41E-12 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 1.26E-08 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 7.58E-11 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 1.54E-08 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 7.33E-12 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 6.70E-10 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 6.87E-10 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 5.33E-06 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 2.17E-15 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 5.79E-10 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610446203 NA 3.65E-10 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251