\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610394032:

Variant ID: vg0610394032 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10394032
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTGCTCGGAATACTTATTATTCAGCCAACTTAAATGCATGAGATTTGCTCCGGTCCACCAAAAATTACCTCGAGGTACTAGTACCTCATGGTACCAAAT[C/T]
GTTTCCGATCGTGAAACGATTTGGTACCGTCAGTTACCGTACCTAGAGATCTAAATGCATAGGGGCATTTGGAATGTGCACTTAACAGTTGTTTGAACAC

Reverse complement sequence

GTGTTCAAACAACTGTTAAGTGCACATTCCAAATGCCCCTATGCATTTAGATCTCTAGGTACGGTAACTGACGGTACCAAATCGTTTCACGATCGGAAAC[G/A]
ATTTGGTACCATGAGGTACTAGTACCTCGAGGTAATTTTTGGTGGACCGGAGCAAATCTCATGCATTTAAGTTGGCTGAATAATAAGTATTCCGAGCAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.10% 26.30% 2.84% 40.84% NA
All Indica  2759 12.10% 28.80% 4.24% 54.87% NA
All Japonica  1512 49.70% 27.60% 0.86% 21.83% NA
Aus  269 83.30% 2.60% 0.37% 13.75% NA
Indica I  595 11.40% 3.50% 2.02% 83.03% NA
Indica II  465 5.20% 18.30% 2.15% 74.41% NA
Indica III  913 14.50% 46.40% 5.59% 33.52% NA
Indica Intermediate  786 13.90% 33.70% 5.60% 46.82% NA
Temperate Japonica  767 42.50% 48.50% 1.04% 7.95% NA
Tropical Japonica  504 62.70% 0.80% 0.40% 36.11% NA
Japonica Intermediate  241 45.20% 17.40% 1.24% 36.10% NA
VI/Aromatic  96 85.40% 3.10% 0.00% 11.46% NA
Intermediate  90 34.40% 20.00% 3.33% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610394032 C -> T LOC_Os06g17910.1 upstream_gene_variant ; 3065.0bp to feature; MODIFIER silent_mutation Average:13.182; most accessible tissue: Callus, score: 64.645 N N N N
vg0610394032 C -> T LOC_Os06g17900.1 downstream_gene_variant ; 3567.0bp to feature; MODIFIER silent_mutation Average:13.182; most accessible tissue: Callus, score: 64.645 N N N N
vg0610394032 C -> T LOC_Os06g17900-LOC_Os06g17910 intergenic_region ; MODIFIER silent_mutation Average:13.182; most accessible tissue: Callus, score: 64.645 N N N N
vg0610394032 C -> DEL N N silent_mutation Average:13.182; most accessible tissue: Callus, score: 64.645 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610394032 NA 1.23E-11 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0610394032 NA 3.02E-13 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 5.58E-13 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 4.92E-06 NA mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 1.48E-06 1.66E-15 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 9.17E-12 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 9.54E-08 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 3.79E-10 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 2.71E-07 mr1215 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 2.27E-08 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 1.99E-09 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 4.96E-11 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 9.22E-10 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 9.89E-07 9.89E-07 mr1260 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 6.35E-09 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 2.84E-11 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 9.72E-07 2.24E-08 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 5.00E-07 NA mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 2.46E-06 5.37E-18 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 5.89E-13 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 3.03E-09 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 7.64E-07 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 3.26E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 1.02E-07 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 7.84E-15 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 4.67E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 2.64E-12 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 2.02E-09 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 1.43E-11 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 8.37E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 1.25E-10 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 8.81E-11 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 7.98E-13 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 1.59E-08 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 1.43E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 3.75E-08 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 5.21E-09 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 2.16E-09 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394032 NA 1.89E-08 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251