Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610318906:

Variant ID: vg0610318906 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10318906
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGAAAGTTGATTCTGGGGATGCTATACAGTTCGTTCAAGAGCATATAATCTATCGATTTGGTATCCCTCAAACTATTACGACTGATCAAGGTTCAATTTT[T/C]
GTATCCAATGAATTTGTTCAGTTTGTCGATAGTATGGGAATTAAAATGTTGAATTCTTCACCGTATTATGCACAAGTTAATGGGCAGGCCGAGGCATCTA

Reverse complement sequence

TAGATGCCTCGGCCTGCCCATTAACTTGTGCATAATACGGTGAAGAATTCAACATTTTAATTCCCATACTATCGACAAACTGAACAAATTCATTGGATAC[A/G]
AAAATTGAACCTTGATCAGTCGTAATAGTTTGAGGGATACCAAATCGATAGATTATATGCTCTTGAACGAACTGTATAGCATCCCCAGAATCAACTTTCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.20%	4.00%	10.75%	55.99%	NA
All Indica	2759	6.00%	1.10%	12.61%	80.32%	NA
All Japonica	1512	58.50%	10.60%	7.61%	23.21%	NA
Aus	269	82.50%	0.00%	9.67%	7.81%	NA
Indica I	595	9.10%	2.40%	1.68%	86.89%	NA
Indica II	465	1.50%	1.50%	6.02%	90.97%	NA
Indica III	913	3.70%	0.20%	26.51%	69.55%	NA
Indica Intermediate	786	9.00%	0.80%	8.65%	81.55%	NA
Temperate Japonica	767	48.80%	20.10%	12.65%	18.51%	NA
Tropical Japonica	504	64.70%	0.40%	1.19%	33.73%	NA
Japonica Intermediate	241	76.80%	2.10%	4.98%	16.18%	NA
VI/Aromatic	96	84.40%	0.00%	15.62%	0.00%	NA
Intermediate	90	30.00%	1.10%	4.44%	64.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610318906	T -> C	LOC_Os06g17780.1	upstream_gene_variant ; 3446.0bp to feature; MODIFIER	silent_mutation	Average:17.125; most accessible tissue: Minghui63 root, score: 29.362	N	N	N	N
vg0610318906	T -> C	LOC_Os06g17800.1	downstream_gene_variant ; 954.0bp to feature; MODIFIER	silent_mutation	Average:17.125; most accessible tissue: Minghui63 root, score: 29.362	N	N	N	N
vg0610318906	T -> C	LOC_Os06g17780-LOC_Os06g17800	intergenic_region ; MODIFIER	silent_mutation	Average:17.125; most accessible tissue: Minghui63 root, score: 29.362	N	N	N	N
vg0610318906	T -> DEL	N	N	silent_mutation	Average:17.125; most accessible tissue: Minghui63 root, score: 29.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610318906	3.08E-09	NA	mr1068	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906	8.17E-07	2.41E-08	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906	1.17E-06	1.10E-08	mr1087	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906	8.66E-08	NA	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906	4.91E-06	7.62E-08	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906	NA	7.48E-07	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906	7.58E-06	NA	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906	NA	1.70E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906	NA	5.99E-07	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906	5.75E-08	NA	mr1211	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906	1.93E-07	3.44E-08	mr1211	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906	6.14E-06	NA	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906	NA	2.02E-06	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906	NA	7.94E-07	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906	2.82E-06	NA	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906	NA	1.35E-07	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251