\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610318906:

Variant ID: vg0610318906 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10318906
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAAAGTTGATTCTGGGGATGCTATACAGTTCGTTCAAGAGCATATAATCTATCGATTTGGTATCCCTCAAACTATTACGACTGATCAAGGTTCAATTTT[T/C]
GTATCCAATGAATTTGTTCAGTTTGTCGATAGTATGGGAATTAAAATGTTGAATTCTTCACCGTATTATGCACAAGTTAATGGGCAGGCCGAGGCATCTA

Reverse complement sequence

TAGATGCCTCGGCCTGCCCATTAACTTGTGCATAATACGGTGAAGAATTCAACATTTTAATTCCCATACTATCGACAAACTGAACAAATTCATTGGATAC[A/G]
AAAATTGAACCTTGATCAGTCGTAATAGTTTGAGGGATACCAAATCGATAGATTATATGCTCTTGAACGAACTGTATAGCATCCCCAGAATCAACTTTCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.20% 4.00% 10.75% 55.99% NA
All Indica  2759 6.00% 1.10% 12.61% 80.32% NA
All Japonica  1512 58.50% 10.60% 7.61% 23.21% NA
Aus  269 82.50% 0.00% 9.67% 7.81% NA
Indica I  595 9.10% 2.40% 1.68% 86.89% NA
Indica II  465 1.50% 1.50% 6.02% 90.97% NA
Indica III  913 3.70% 0.20% 26.51% 69.55% NA
Indica Intermediate  786 9.00% 0.80% 8.65% 81.55% NA
Temperate Japonica  767 48.80% 20.10% 12.65% 18.51% NA
Tropical Japonica  504 64.70% 0.40% 1.19% 33.73% NA
Japonica Intermediate  241 76.80% 2.10% 4.98% 16.18% NA
VI/Aromatic  96 84.40% 0.00% 15.62% 0.00% NA
Intermediate  90 30.00% 1.10% 4.44% 64.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610318906 T -> C LOC_Os06g17780.1 upstream_gene_variant ; 3446.0bp to feature; MODIFIER silent_mutation Average:17.125; most accessible tissue: Minghui63 root, score: 29.362 N N N N
vg0610318906 T -> C LOC_Os06g17800.1 downstream_gene_variant ; 954.0bp to feature; MODIFIER silent_mutation Average:17.125; most accessible tissue: Minghui63 root, score: 29.362 N N N N
vg0610318906 T -> C LOC_Os06g17780-LOC_Os06g17800 intergenic_region ; MODIFIER silent_mutation Average:17.125; most accessible tissue: Minghui63 root, score: 29.362 N N N N
vg0610318906 T -> DEL N N silent_mutation Average:17.125; most accessible tissue: Minghui63 root, score: 29.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610318906 3.08E-09 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906 8.17E-07 2.41E-08 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906 1.17E-06 1.10E-08 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906 8.66E-08 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906 4.91E-06 7.62E-08 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906 NA 7.48E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906 7.58E-06 NA mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906 NA 1.70E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906 NA 5.99E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906 5.75E-08 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906 1.93E-07 3.44E-08 mr1211 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906 6.14E-06 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906 NA 2.02E-06 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906 NA 7.94E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906 2.82E-06 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610318906 NA 1.35E-07 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251