| Variant ID: vg0610285178 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10285178 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTAGATTAACAGAGACATATGATAAATAGGTAGGCAAATATATCATCCAAACCAGAGCAATCCAAAAGGTCGAATGTACTGATGCAGCCTTGAACGACGC[C/T]
GATGTAAACGATATAATTGCCTGGGCCGGCGAAACATCGGTGCAGCCCCGCGTCAGGTGCCAAGTCCCGCCGGACGATAAAATAAAGTAGAAAAGGTAAA
TTTACCTTTTCTACTTTATTTTATCGTCCGGCGGGACTTGGCACCTGACGCGGGGCTGCACCGATGTTTCGCCGGCCCAGGCAATTATATCGTTTACATC[G/A]
GCGTCGTTCAAGGCTGCATCAGTACATTCGACCTTTTGGATTGCTCTGGTTTGGATGATATATTTGCCTACCTATTTATCATATGTCTCTGTTAATCTAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.80% | 4.30% | 0.89% | 0.00% | NA |
| All Indica | 2759 | 92.90% | 5.70% | 1.41% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 84.80% | 15.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.60% | 2.50% | 4.87% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.90% | 10.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 92.50% | 6.40% | 1.15% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610285178 | C -> T | LOC_Os06g17700.1 | upstream_gene_variant ; 4894.0bp to feature; MODIFIER | silent_mutation | Average:30.506; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
| vg0610285178 | C -> T | LOC_Os06g17710.1 | upstream_gene_variant ; 982.0bp to feature; MODIFIER | silent_mutation | Average:30.506; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
| vg0610285178 | C -> T | LOC_Os06g17730.1 | upstream_gene_variant ; 2459.0bp to feature; MODIFIER | silent_mutation | Average:30.506; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
| vg0610285178 | C -> T | LOC_Os06g17720.1 | downstream_gene_variant ; 521.0bp to feature; MODIFIER | silent_mutation | Average:30.506; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
| vg0610285178 | C -> T | LOC_Os06g17710-LOC_Os06g17720 | intergenic_region ; MODIFIER | silent_mutation | Average:30.506; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610285178 | 2.02E-08 | NA | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610285178 | 8.84E-13 | NA | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610285178 | NA | 4.87E-06 | mr1098 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610285178 | 6.90E-12 | NA | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610285178 | 1.04E-06 | 2.12E-08 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610285178 | 4.96E-06 | NA | mr1244 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610285178 | 4.61E-06 | NA | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610285178 | 3.51E-12 | NA | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610285178 | NA | 1.23E-06 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610285178 | 2.42E-13 | NA | mr1211_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610285178 | 3.06E-06 | 5.80E-09 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |