\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610285178:

Variant ID: vg0610285178 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10285178
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAGATTAACAGAGACATATGATAAATAGGTAGGCAAATATATCATCCAAACCAGAGCAATCCAAAAGGTCGAATGTACTGATGCAGCCTTGAACGACGC[C/T]
GATGTAAACGATATAATTGCCTGGGCCGGCGAAACATCGGTGCAGCCCCGCGTCAGGTGCCAAGTCCCGCCGGACGATAAAATAAAGTAGAAAAGGTAAA

Reverse complement sequence

TTTACCTTTTCTACTTTATTTTATCGTCCGGCGGGACTTGGCACCTGACGCGGGGCTGCACCGATGTTTCGCCGGCCCAGGCAATTATATCGTTTACATC[G/A]
GCGTCGTTCAAGGCTGCATCAGTACATTCGACCTTTTGGATTGCTCTGGTTTGGATGATATATTTGCCTACCTATTTATCATATGTCTCTGTTAATCTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 4.30% 0.89% 0.00% NA
All Indica  2759 92.90% 5.70% 1.41% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.13% 0.00% NA
Aus  269 84.80% 15.20% 0.00% 0.00% NA
Indica I  595 92.60% 2.50% 4.87% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 89.90% 10.00% 0.11% 0.00% NA
Indica Intermediate  786 92.50% 6.40% 1.15% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610285178 C -> T LOC_Os06g17700.1 upstream_gene_variant ; 4894.0bp to feature; MODIFIER silent_mutation Average:30.506; most accessible tissue: Zhenshan97 root, score: 44.635 N N N N
vg0610285178 C -> T LOC_Os06g17710.1 upstream_gene_variant ; 982.0bp to feature; MODIFIER silent_mutation Average:30.506; most accessible tissue: Zhenshan97 root, score: 44.635 N N N N
vg0610285178 C -> T LOC_Os06g17730.1 upstream_gene_variant ; 2459.0bp to feature; MODIFIER silent_mutation Average:30.506; most accessible tissue: Zhenshan97 root, score: 44.635 N N N N
vg0610285178 C -> T LOC_Os06g17720.1 downstream_gene_variant ; 521.0bp to feature; MODIFIER silent_mutation Average:30.506; most accessible tissue: Zhenshan97 root, score: 44.635 N N N N
vg0610285178 C -> T LOC_Os06g17710-LOC_Os06g17720 intergenic_region ; MODIFIER silent_mutation Average:30.506; most accessible tissue: Zhenshan97 root, score: 44.635 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610285178 2.02E-08 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610285178 8.84E-13 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610285178 NA 4.87E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610285178 6.90E-12 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610285178 1.04E-06 2.12E-08 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610285178 4.96E-06 NA mr1244 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610285178 4.61E-06 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610285178 3.51E-12 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610285178 NA 1.23E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610285178 2.42E-13 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610285178 3.06E-06 5.80E-09 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251